0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "LINGUISTIC COHERENCE: A PLAN-BASED ALTERNATIVE" doc

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "LINGUISTIC COHERENCE: A PLAN-BASED ALTERNATIVE" doc

... LINGUISTIC COHERENCE: A PLAN-BASED ALTERNATIVE Diane J. Litman AT&T Bell Laboratories 3C-40 8A 600 Mountain Avenue Murray Hill, NJ 079741 ABSTRACT To fully understand a sequence of utterances, ... plans active at any point in a dialogue, a dialogue context in the form of a plan stack is built and maintained by the plan recognizer. Various models of discourse have argued that an ideal ... abstraction as a single action achieving a goal, such an action might not be executable, i.e. it might be an abstract as opposed to primitive action. Abstract actions are in actuality composed...
  • 9
  • 235
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... jbc.M110.177246.24 Doi H, Okamura K, Bauer PO, Furukawa Y, ShimizuH, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-interacting protein ... of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical scavenger [36]. Thus, it may bespeculated that dopamine exhibits a beneficial...
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx

Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx

... Sanchez R, Pantoja-Uceda D, Prieto J, Diercks T,Marcaida MJ, Montoya G, Campos-Olivas R &Blanco FJ (2010) Solution structure of human growtharrest and DNA damage 45alpha (Gadd45alpha) andits ... anticodon by a specificsynthase, most bacteria and all archaeons lack glutami-nyl-tRNAGlnsynthase. They produce Gln-tRNAGlnin a two-step pathway: glutamylation of the tRNAGln(bythe same low-specificity ... Structural basis for cAMP-mediated allosteric control of the cataboliteactivator protein. Proc Natl Acad Sci USA 106,6927–6932.17 Nikolova EN, Kim E, Wise AA, O’Brien PJ, Andri-cioaei I & Al-Hashimi...
  • 8
  • 586
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitrificans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... FEBS23 Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & ... total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis and...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... Biochemistry andMolecular and Structural Biology, JozefStefan Institute, Jamova 39, SI-1000Ljubljana, SloveniaFax: +386 1 477 3984Tel: +386 1 477 3215E-mail: dusan.turk@ijs.siDatabaseThe coordinates ... theP1 data set is a consequence of highly anisotropic diffrac-tion, which forced us to discard part of the collected datato maintain reasonable merging statistics. The anisotropywas a consequence...
  • 8
  • 632
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: Vaccines against malaria – an update doc

Tài liệu Báo cáo khoa học: Vaccines against malaria – an update doc

... towards a malaria vaccine.Naturally acquired immunity)imitatenature to advance the immuneresponses of malaria-naı¨ve individuals A key observation in malaria-endemic regions is thegradual ... AS0 2A candidate malaria vaccine in Gambianchildren. Vaccine 23, 4148–4157.27 Macete E, Aponte JJ, Guinovart C, Sacarlal J, Ofori-Anyinam O, Mandomando I, Espasa M, Bevilacqua C,Leach A, Dubois ... Alonso PL, Sacarlal J, Aponte JJ, Leach A, Macete E,Milman J, Mandomando I, Spiessens B, Guinovart C,Espasa M et al. (2004) Efficacy of the RTS,S ⁄ AS0 2A vaccine against Plasmodium falciparum infection...
  • 8
  • 462
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into ... 5¢-AAGCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATCCAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full-length Skn cDNA, whose termination codon was changedto a BamHI site, was inserted between the SalI and ... respectively.C25S and C19 9A mutations of Shh were introduced byPCR using primers 5¢-CCTGCAGCAGCGGCAGGCAAGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGGCCGGGGCACACCAG-3¢, and primers 5¢-GGCATGCTGGCTCGCCTGGCTGTGGAAGCA-3¢...
  • 14
  • 499
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vesselendothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,paraformaldehyde;...
  • 11
  • 873
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015