Tài liệu Báo cáo khoa học: "DESIGN OF A KNOWLEDGE-BASED REPORT GENERATOR" doc
Tài liệu Báo cáo khoa học: "DESIGN OF A KNOWLEDGE-BASED REPORT GENERATOR" doc
... generate natural language summaries from computer databases. For example, knowledge-based report generators can be designed to generate daily stock market reports from a stock quotes database, ... database, daily weather reports from a meteorological database, weekly sales reports from corporate databases, or quarterly economic reports from U. S. Commerce Department databases, etc. A separate ... pattern-recognition nature of these grammar rules and their use of the lexicon, they may be viewed as a high-level variant of a lexical functional grammar. 5 The efficacy of a low-level functional grammar for...
- 6
- 452
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... MPTP andMPP+can facilitate aggregation of a- synuclein in theabsence of any cellular machinery.It has been proposed that the auto-oxidation product of dopamine interacts with protofibrillar a- synucleinand ... of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical scavenger [36]. Thus, it may bespeculated that dopamine exhibits a beneficial...
- 11
- 754
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...
- 16
- 646
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... isolation and long-termculture of organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki ... Ag-expressingendothelial cellpAloxP loxPpAtsA58TCAGtsA58TCAGEnzymatic digestion of organsCulture at 33 °CSerial passages every 2–3 daysat split ratio 1 : 3day 20–30day 0βgeoFig. 1. An endothelial...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... University of Utah, Salt Lake City, UT, USA3 Department of Physiology and Biophysics, University of Aarhus, Denmark4 Department of Medical Biochemistry, University of Aarhus, Denmark5 Department of ... 4753Application of a fluorescent cobalamin analoguefor analysis of the binding kinetics A study employing recombinant human transcobalaminand intrinsic factorSergey N. Fedosov1, Charles...
- 12
- 603
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
... Ohno-Iwashita Y, Shimada Y, Waheed AA, HayashiM, Inomata M, Nakamura M, Maruya M & Iwashita S(2004) Perfringolysin O, a cholesterol-binding cytolysin,as a probe for lipid rafts. Anaerobe ... 10, 125–134.19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M,Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno-Iwashita Y (2001) Selective binding of perfringolysin Oderivative to cholesterol-rich ... clustering and segregation of Lck and LAT onthe inner leaflet of the plasma membrane [12]. Thesemorphological analyses suggest the existence of raftsubsets. There are some biochemical approaches...
- 10
- 588
- 0
Tài liệu Báo cáo khoa học: "Demonstration of a POMDP Voice Dialer" ppt
... WilliamsAT&T Labs – Research, Shannon Laboratory180 Park Ave., Florham Park, NJ 07932, USAjdw@research.att.comAbstractThis is a demonstration of a voice di-aler, implemented as a partially observableMarkov ... state feature vectors. During opti-mization, a set of template state feature vectors aresampled, and values are computed for each actionmnemonic at each template state feature vector.Finally, ... beliefstate. Initially, all of the belief is held by the mas-ter, undifferentiated partition, which is shown as a green bar and always shown first. As names are rec-ognized, they are tracked separately,...
- 4
- 479
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Pichia pastoris. Sinapinic matrix adducts are shown.Fig. 3. Electrophoretic analysis and purification of recombinant ASP3c. (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichiapastoris....
- 11
- 642
- 0
Tài liệu Báo cáo khoa học: "LINGUISTIC COHERENCE: A PLAN-BASED ALTERNATIVE" doc
... domain plans active at any point in a dialogue, a dialogue context in the form of a plan stack is built and maintained by the plan recognizer. Various models of discourse have argued that an ... Decompositions enable hierarchical plan- ning. Although the action description of. the header may be usefully thought of at one level of abstraction as a single action achieving a goal, such an action ... discourse plans in a plan-based theory of dialogue understanding. This allows the specification and formalization of the relationships within a compu- tational framework, and enables a plan recognition...
- 9
- 235
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khiNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ