Tài liệu Báo cáo Y học: A family of expressed antifreeze protein genes from the moth, Choristoneura fumiferana ppt
Tài liệu Báo cáo Y học: A family of expressed antifreeze protein genes from the moth, Choristoneura fumiferana ppt
... concentration of the cryoprotectant, glycerol, 10-fold and desiccate to 40% of the prediapause water content [4]. Taken together,these adaptations may explain the impressive ability of C. fumiferana ... A family of expressed antifreeze protein genes from the moth, Choristoneura fumiferana Daniel Doucet, Michael G. Tyshenko, Peter L. Davies and Virginia K. WalkerDepartment of Biology, Queen's ... family (Fig. 3A, B), andbecause the hybridization signals were distributed betweenseveral, nonidentical large f ragments of DNA, it is likelythat at least some of the 17 genes of the family are...
- 9
- 422
- 0
Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx
... reaction the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activityin a single enzyme. No other enzyme has been reportedto catalyse ... shown).Substrate specificityArangeofa,b-unsaturated aldehydes were tested assubstrates for citral lyase (Table 2). As the total activity of the partially purified citral lyase is relatively low (Table ... size of these hydratase/aldolase enzymes. All of these enzymesexhibit more then 75% of their maximum activity at pH 7.6, the optimum pH of citral lyase [27,30–32]. Whereas, manybacterial aldolases...
- 8
- 575
- 0
Tài liệu Báo cáo Y học: A pool of Y2 neuropeptide Y receptors activated by modifiers of membrane sulfhydryl or cholesterol balance pot
... little accumulationdue to receptor externalization The dynamics of appearance of additional surface sites at30 lMPAO indicated a fast activation, as the increase in the labeling by agonist ... selectivity and the economy of action. Scavenging by cell membrane- residentectoproteinases by way of in situ encounters with extra-cellular agonists may not satisfy the clearance needscreated by agonist ... be accessed by alteration of sulfhydryl balance or fluidity of the cell membrane, andby treatments that a ect the anchoring and aggregation of membrane proteins.Keywords: receptor sequestration;...
- 8
- 469
- 1
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... details of the catalytic capacity of the isoforms as well as of the d ifferential regulation of t heisozymes in re lation to specialized branc hes of phenylpro-panoid metabolism.Molecular analysis ... and the dynamics of theirsynthesis. In any case, the coordinated r egulation of 4 CL3or 4 with a ll other known enzymes of phytoalexin biosyn-thesis in soybean [24] indic ate that at least these ... analysis of the 4CL gene family in soybeanSoybean cell cultures have been reported to contain the 4CL1 and 4CL2 isoforms [1]. Of these, 4CL1 is capable of catalysing the activation of the broadest...
- 12
- 448
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... suggest that certain enzymes, andtherefore the corresponding genes of the A2 0 1A biosyn-thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways,respectively. The ... similarities with several products from the purcluster of S. alboniger [6]. They were accordingly namedataP3, ataP5, ataP4, ataP10 and ataP7. The two additionalones were named ata12 and ataPKS1 ... permitted the isola-tion of Streptomyces antibioticus genes implicated inoleandomycin biosynthesis [40].Gene analyses and enzymatic assays suggest that the biosynthetic pathways of the aminonucleoside...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... mMFe(NH4)2(SO4)2slightly increased the activity. Other metal salts did not affect the enzyme activity.Fig. 3. Absorption spectra of the reaction products from the cleavage of 4-amino-3-hydroxybenzoate. (A) Reaction ... Murakami, S., Nakanishi, Y. , Kodama, N., Takenaka, S., Shinke,R. & Aoki, K. (1998) Purification, characterization, and geneanalysis of catechol 2,3-dioxygenase from the aniline-assimilatingbacterium ... were purchased from TokyoKasei Kogyo (Tokyo, Japan), meat extract (ExtractEhlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan)and 4-aminoresorcinol hydrochloride was from Aldrich(Milwaukee,...
- 7
- 490
- 0
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... amyloiddisease [22].MATERIALS AND METHODSMaterials The b-casein w as prepared from whole a cid casein b y the urea fractionation method of Aschaffenburg [35]. The j-casein was prepared by adaptation of ... were also attempted on a S1-and a S2-casein, these proteins had a tendency to aggregate in the laser beam, which prevented the acquisition of ROA data of suf®cient quality for reliable analysis. ... nativeproteins are already in an unfolded state, s uch m ild acidicconditions are unlikely to alter the conformation signi®-cantly. The backscattered Raman and R OA spectra of the wild-type and mutant tau46...
- 9
- 667
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... franciscanaOligomerization and thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCTp26-CD10 183–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182(P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGTp26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA ... developing embryos of the brine shrimp,Artemia franciscana, synthesize abundant quantities of a small heat shock /a- crystallin protein, termed p26. Wild-typ ep26 functions as a molecular chaperone...
- 10
- 495
- 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... likely mediated byactivation of the MAPK pathway and that this response issubstantially independent of the JAK/STAT pathway.DISCUSSIONWe have successfully expressed an active fusion protein of human ... were analyzed by SDS/PAGE [31] and visual-ized by fluorography using the fluorographic intensifiersolution ÔAmplifyÕ (Amersham International, Aylesbury,UK).Proliferation assaysBAF/gp130 and BAF/gp130/LIF-R ... longerthan twice the diameter of the cell bodies appear within a day, and maximal response is reached in 2 days. For directcomparison, the amount of responsiveness was evaluatedforallfactorsat48h.AspresentedinFig.5B,Hyper-CNTF...
- 9
- 442
- 0
Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt
... TotalRNA was prepared from epididymal fat pads harvested from ob ⁄ obmice and genetically matched lean mice. Levels of miRNA expres-sion were analyzed by TaqMan quantitative PCR. Data are meanvalue ... treated as described in (A) . Total RNA wasprepared at the indicated times and subjected to quantitative real-time PCR analysis. The data shown are mean value ± standard errors of the mean from ... miR-2 7a appeared to decrease the levels of PPARc and C ⁄ EBPa mRNA at 72 h after transfection(Fig. 4D), suggesting that miR-2 7a may target an asyet unknown gene or pathway that negatively regulatesthe...
- 11
- 848
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ