Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc

... Sheil Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam VIETNAM11. Research context and objectives Vietnam has been reforming its forest management in favour of ... better articulate local people’s priorities for the future, their hopes and values as well as their relationship with the conservation area. Biodiversity and Local Perceptions on the Edge of a Conservation ...  Ardisia quinquegona var. latifoliaMyrsinaceae - 1 Maesa balansaeMyrsinaceae Dong don 3  Maesa perlariusMyrsinaceae A long 4  Acmena cf. acuminatissimaMyrtaceae A long choang...

Tài liệu Báo cáo khoa học: On the mechanism of action of the antifungal agent propionate Propionyl-CoA inhibits glucose metabolism in Aspergillus nidulans doc

... extract and water to a ﬁnal volume of 980 lL. The reaction was started by t he addition of 20 lL of a 100 mMATP solution (ﬁnal concentration 2 mM )and the reduction of NAD was monitored at ... via the methylcitrate cycle [2,3]. Propionyl-CoAis formed from propionate, CoASH and ATP catalysed b yacetyl-CoA synthetase, F acA [4,5], and by an additionalacyl-CoA synthetase. The condensation ... acetate orpropionate as well as the ability to decompose propionyl-CoA by the transfer of the CoA-moiety to acetate by the action of a CoA-transferase. The wild-type and the methylcitrate synthase...

Tài liệu Báo cáo khoa học: "ON THE REPRESENTATION OF QUERY TERM RELATIONS BY SOFT BOOLEAN oPERATORS" ppt

... higher the p-value attached to an operator, the closer is the interpretation of that operator in accordance with the rules of ordinary Boolean logic. On the other hand, the smaller the p-value, ... incorporated in an and- clause. The or-operator, on the other hand, is a device for specifying a group of synonymous terms, or alternatively, a thesaurus class of terms in which all terms are treated ... operators and, or, and no~. Of particular interest in a linguistic context are the and and or operators: a) b) The and- operator is a device for specifying a compulsory phrase where all...

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢. The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢ ... higher than the native cold adapted enzyme (Table 1). The mutantG26 1A/ Y26 9A exhibits an E a almost the same as in the caseofthenativeenzyme(Table1).Thermal inactivation of mutant and wild-type ... with the aromatic ring of Tyr269, and theseunfavorable interactions could lead to a decrease of local ﬂexibility and an increased E a value. The validity of the above interpretation was furtherreinforced...

Tài liệu Báo cáo khoa học: Inﬂuence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... A 3where A 1, A 2, and A 3are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2are the apparentexchange rate constants for the fast and slow amide pro-tons. Results ... free-energy of activation for reactions (A) acylation (DG„k2) and (B)deacylation steps (DG„k3) for the Lac -a- CT (s) and Dex -a- CT (n)conjugates.Table 5. Thermodynamic activation parameters ... revealedthat both the kinetics of enzyme acylation (k2) and deacylation (k3) are reduced by chemical glycosylation,also as a function of the glycan molar content of the conjugates (Table...

Tài liệu Module 6: Transaction Processing on the Business Logic Layer docx

... However, if the client is non-transactional, COM+ will create a transaction before activating the object. Requires new transaction The component will always begin a transaction regardless of its ... Supports transactions The component agrees to participate in a transaction only if its client provides one. Requires transactions The component can participate in its client's transaction. ... made permanent only if the whole transaction succeeds. COM+ provides automatic transaction support for components that are marked as transactional in the COM+ Catalog. Therefore, the component...

Tài liệu How To Acquire Customers On The Web pptx

... GARINONICHOLAS G. CARRMICHAEL BEER AND NITIN NOHRIA MODERATEDBY DENNIS CAREYANDREW HARGADON AND ROBERT I. SUTTONWARREN BENNIS AND JAMES O’TOOLEPAUL NUNES, DIANE WILSON, AND AJIT KAMBIL A CONVERSATION ... 400,000 affiliates. By one estimate, 16% of on- line marketers participate in a revenue-sharing affiliate program. And although CD-now and Amazon have amassed the largest number of marketing partners, ... Acquire Customers on the Webby Donna L. Hoffman and Thomas P. NovakReprint r00305MAY – JUNE 2000Reprint NumberKEVIN WERBACHSTEVEN KAPLAN AND MOHANBIR SAWHNEYRANJAY GULATI AND JASON GARINONICHOLAS...

Tài liệu Speaking and Writing Strategies for the TOEFL iBT part 5 pptx

... and the TV at home. Also, zoos look after endangered animals like pandas. I saw two in the Washington DC zoo last year and they had a baby. If there were no zoos, the pandas would disappear ... Best of all, they can leave the internet and the TV at home. TiC = specific = Also, zoos look after endangered animals like pandas. I saw two in the Washington DC zoo last year and they ... demonstrates a variety of rhetorical strategies, including: the student, family and panda examples; the student, family and panda example; on TV, they [lions] looked so small,...

Tài liệu Speaking and Writing Strategies for the TOEFL iBT part 6 pdf

... is Thai. There is a great Thai restaurant near my apartment. It is called The Bangkok. The service there is very fast and the food is always excellent, especially the pad Thai and the curry ... in each body paragraph, and you show a reason based on a cause -and- effect relationship in your concluding sentence (TiC). You can fix a lack of body paragraph development two ways. ... like about the place I call my home, New Delhi in India. For example, the delicious food. There are many kinds of food. Also, there are a lot of restaurants and the prices are very reasonable...

Tài liệu Speaking and Writing Strategies for the TOEFL iBT part 7 docx

... What are the advantages and disadvantages of owning a car? State your opinion using illustrations and reasons. Prompt What are the advantages and disadvantages of owning a car? State ... disadvantages Personally, I think there is the advantages and disadvantages to be own the car. For example, I have a Honda care. Every time I drives to work. Before I have to take the ... Sometimes the bus misses me and I am late for work. Then I saved my money and bought a Honda care. Now I am always on time and my boss he no get angry no more for being so late so owning a Honda car...

Xem thêm

Từ khóa: periurban and urban consumers on the reasons for not consuming organic products the two main reasons advanced is that organic products are expensive according to 60 of the consumers in the transkei this book provides information on the clinical relevance of blood groups and on the importance of blood group antibodies in transfusion medicine in particular tài liệu dạy cách đối nhân xử thế on the role of context and prosody tài liệu đồ họa máy tính bùi thế duy Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ