Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel subtype of thyrotropin-releasing hormone receptor ppt

... (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); thirdset, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATGCAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCAGATAC-3¢) (Fig. 1C). ... (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGATCACC-3¢), respectively. The PCR ... Bidaud et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... ﬁlter paper assay and tritium-labeledsubstrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. kcatwas calculated usingMw(HPRT) = 27132 Da and ... phosphoribosyl-transferase activity [10].The structural characterization of numerous com-plexes of the human HPRT and several bacterial and protozoan HPRTs have been undertaken [13–17]. Thestructure of...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMPkinases from gram-negative and gram-positive bacteria.J Biol Chem 282, 7242–7253.18 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin A& amp;Baˆ rzu O (1998) Mutational analysis of UMPkinase ... Ureaplasmaparvum UMP kinase – a potential antibacterial drug targetLouise Egeblad-Welin1, Martin Welin2,*, Liya Wang1 and Staffan Eriksson11 Department of Anatomy, Physiology and Biochemistry, ... in a variety of diseases such as urethritis and prostatitis. Duringpregnancy, it is an opportunistic pathogen and cancause spontaneous abortions and premature birth. Thebacteria can be transferred...

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... members of family 28 of the glycosidehydrolases, including the endopolygalacturonases, exo-polygalacturonases and rhamnogalacturonases [3,4].Although a handful of endopolygalacturonases, gener-ally ... tubingensis (CAA68128.1), Pgx2 Arabi-dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in paren-theses. A question mark indicates ... exo-acting polygalacturonasescommonly generate digalacturonate, PelB was shownto liberate monogalacturonic acid as the ﬁrst and onlyproduct on PGA and oligoGalpA. On the basis of itsmode of action,...

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... Molecular and functional characterization of adenylate kinase 2gene from Leishmania donovaniHe´ctor Villa1, Yolanda Pe´rez-Pertejo1, Carlos Garcı´ a- Estrada1, Rosa M. Reguera1, ... donovani as well as its expression and molecular characterization. Materials and methodsMaterialsPlasmids pGEM-3Zf(+) and pQE30 were from Promega and QIAGEN, respectively. [32P]dCTP[aP] (3000 ... of the gene encoding AK2 from a genomiclibrary of Leishmania donovani and alsoits expression in leishmania promastigote cultures. AK2 waslocalized on an 1.9-Mb chromosomal bandas a single copygene....

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation ... AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... anunusual feature shared by only a handful of prokary-otic CYP proteins [4,8,25].In comparison, the NOS ﬂavoprotein domain isrelated to a family of dual-ﬂavin enzymes that containFAD and FMN, and ... prevented anaccurate measure of the koffparameter in CaM-boundeNOS and nNOS [58], and thus prevented assessment of the relative importance of conformational changerates versus rates of FMNH2formation ... CT and bound NADPH have been studiedin detail. An interesting and possibly novel connectionappears to link regulation of Keq A by the CT and Table 1. Factors that may alter conformational...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: probes of hydrogen tunnelling pptx

... cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions may be a large reorganization energy.The ... 2009)doi:10.1111/j.1742-4658.2009.07121.xAt least half of all enzyme-catalysed reactions are thought to involve a hydrogen transfer. In the last 10 years, it has become apparent that many of these reactions will occur, in part, ... (wt) and N18 9A mutant of MR withNADH. The wt trace is ﬁt to a single exponential and the N18 9A trace to a 4-exponential function – see the main text for moredetails. (Inset) The same data on a...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... cysteines located in both of the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in theattachment of PsaC [12]. PsaC, PsaD and PsaE arelocated at the cytosolic site (Fig. 1A) [2,7,13–16]. ... G, Kusunoki M, Aoki S,Sato D, Kobayashi T, Kita K, Horii T & Hase T(2007) Cloning and characterization of ferredoxin and ferredoxin–NADP+reductase from human malariaparasite. J Biochem ... FMN:apoproteininteraction in Anabaena ﬂavodoxin. Biochemistry 43,15111–15121.27 Fukuyama K, Wakabayashi S, Matsubara H & RogersLJ (1990) Tertiary structure of oxidized ﬂavodoxin from an eukaryotic red alga...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of ... The core of the pro-tein is made up of a nine-stranded b-sheet ﬂanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.5856 ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP