0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

... 2002 A mammalian 14-kDa phosphohistidine phosphatase (Eur. J. Biochem. 269) 5019Cloning and expression of a human 14-kDa phosphohistidine phosphatase Based on the human sequence data a pair of ... existence of a phosphohistidine phosphatase different from protein phosphatase 1, 2A and 2C. A 1000-fold purification to apparent homogeneitygave a 14-kDa phosphatase with a specific activity of 3lmolÆmin)1Æmg)1at ... lgÆmL)1pepstatin A, 100 lgÆmL)1lysozyme and 5 mMEDTA. After freezing,thawing, and ultrasonic treatment the supernatant wascollected and analysed for phosphohistidine phosphatase activity.The...
  • 8
  • 666
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... 142–144 amino-acids long; they are acidic and presumably located in the cytoplasm like UspA.Members of this family share a strikingly similar hydro-pathy profile (data not shown), and UP12 shares ... coli.Escherichia coli cells undergo a transition from a rapidgrowth phase to a stationary phase, which is accompaniedby a variety of physiological changes that affect geneexpression, the structure and ... [15]), was amplified byPCRusinga5¢ complementary deoxyoligonucleotide(5¢-CGCGGATCCATGTATAAGACAATCATTATGC-3¢)containing a BamHI site (underlined nucleotides) and a 3¢deoxyoligonucleotide harboring...
  • 9
  • 548
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... 3-day-old and 7-day-oldcultured schistosomules, 15 day, 21 day, 28 day and 35 day para-sites, adult worm pairs, separated adult female and male worms, and eggs. cDNA from uninfected B. glabrata snails ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate humanparasite Schistosoma ... transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28,4291–4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato S, Imamura...
  • 19
  • 653
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin fromthe hemolymph of the freshwater crabParatelphusa jacquemontiiMaghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya SuriyaDepartment ... linkages [5] on cell-surface glycocon-jugates, namely glycoproteins and glycolipids, or in bacter-ial polysaccharides. Sialic acids are a family of sugars,N-acetylneuraminic acid (NeuAc) or ... specificactivity. Analysis of the lectin on SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa.The binding affinity of the lectin in the hemolymph of the freshwater crab, Paratelphusa...
  • 8
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... and AF501 overlap by 3 bp). The region 81–65 bp upstream of t he start c odon of AF499 was identified asan archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a ... (lane B2). This behavior istypical of integral membrane proteins. The polypeptide with anapparent molecular mass of 53 kDa appears as a double band inunboiled samples (lanes A1 and B1).Table ... indicates that only a half reaction is catalyzed whenonly H -S-CoM is pr esent and that a reaction intermediate of the catalytic cycle is trapped [6]. Variable-temperaturemagnetic circular dichroism...
  • 10
  • 564
  • 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

... xylosoxydans ssp.xylosoxydans A- 6 N-acyl-D-Asparateamidohydrolase; A- 6-D50061: Alcaligenesxylosoxydans ssp. xylosoxydans A- 6 N-acyl-D-glutamate amidohydrolase; Alicaligenesfaecalis-DA1: Alcaligenes ... identity and 63.6% similarity),N-acyl-D-glutamate amidohydrolase (44.8% identity and 51.2% similarity) and N-acyl-D-asparate amidohydrolase(48.5% identity and 56.5% similarity) from Alicaligenesxylosoxydans ... Ishikara, T. & Fukagawa, Y. (1980) Deacetylation of PS-5, a new beta-lactam compound III. Enzymological char-acterization of L-amino acid acylase and D-amino acid acylasefrom Pseudomonas...
  • 11
  • 656
  • 0
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

... redistribution of both actin microfilaments and cytokeratin intermediatefilaments, and with the appearance of a marked cytokeratin and actin immunoreactivity at the cell junctions [28,42]. Thelatter cytoskeleton ... 10)5Mforskolin,an adenylate cyclase activator. A pattern similar to thethyrotropin stimulation was observed in these experimentalconditions.Activation of the tyrosine kinase/MAP kinase pathwayby EGF ... PRK2 kinase is a potentialeffector target of both Rho and Rac GTPases and regulates actincytoskeletal organization. MolCellBiol.17, 2247–2256.13. Watanabe, G., Saito, Y. , Madaule, P., Ishizaki,...
  • 9
  • 394
  • 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... TTRTCNCCCATNACRAARTA Cloning of sipUU1 TTGAAYGCNAARACNATHACNYTNAARAA Cloning of sipUV1 TTGAARAARMGNTTYTGGTTYYTNGC Cloning of sipVV2 GTNTTYATNGTYTAYAARGTNGARGG Cloning of sipVV3 TCNGCRTCNSWNATNACNCCNACNAT ... GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWhW12 CGAGATCTTGTGGACATGGTCCCGTTTC Construction of pOpacWhS1 CGGAATTCGCTAATGGGAGGAAATCAC Construction of pOpacShS2 TACAGATCTTTTCGTCTTGCGAATTTC ... of sipWW7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipWW8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipWW9 GGCGATGTCATCACTTTTACACAA Cloning of sipWW10 AACACACAGAATAATCGGGATCAC Cloning of sipWW11 GAGAATTCAAAAGAAAGCGGGGAAGAA...
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... synthase; AGK, N-acetylglutamate kinase; AGPR,N-acetylglutamate 5-phosphate reductase; AOAT, N-acetylornithinetransaminase; GAT, glutamate N-acetyltransferase; AOD, N-acetyl-ornithine deacetylase; ... second-stepenzymes, N-acetylglutamate synthase and N-acetylglut-amate kinase, respectively, are inhibited by arginine.Glutamate N-acetyltransferase is also weakly inhibitedby arginine [16,17]. As a result, ... study, we characterized wild water-melon glutamate N-acetyltransferase (CLGAT) that catalyses the trans-acetylation reaction between acetylornithine and glutamate to formacetylglutamate and ornithine,...
  • 12
  • 649
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbài 7 theo tài liệu báo cáo kết quả kinh doanh về sản phẩm a của công ty ab trong năm 2005 như sauidenti cation and extraction of a genomic sequence between two markerstài liệu báo cáo nghiên cứu khoa họctai lieu bao cao thuc tap y si da khoatai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo y họctài liệu báo cáotài liệu báo cáo môn triếttài liệu báo cáo tài chínhtài liệu di truyền y họctài liệu báo cáo mônbáo cáo y họctài liệu báo cáo tài chính vốn bằng tiền tai doanh nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ