0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... 505–524.Academic Press, New York, USA.Ó FEBS 2003 Characterization of ccNiR subunits (Eur. J. Biochem. 270) 3915 The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and ... periplasmic pentahemic cytochrome c, NrfB [22].These important developments demand the re-examina-tion of the biochemical properties of D. desulfuri-cans ATCC 27774 ccNiR, and its implications on the existing ... spectroscopic and redox properties of each identified heme from the NrfHA complex.ConclusionsD. desulfuricans ATCC 27774 ccNiR is isolated as a mix-ture of high molecular mass hetero-oligomeric complexes,constituted...
  • 12
  • 593
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... 168PhyA sig-nificantly enhanced their catalytic efficiencies. This is the first report to elu-cidate the substrate specificity of the incomplete domain and the functionalrelationship of tandemly repeated ... toincrease the catalytic efficiency of PhyH-DII. Further-more, the catalytic efficiency of PhyH was much greaterthan that of PhyH-DI and PhyH-DII combined (5.73fold) or twice the amount of PhyH-DII ... (嘙 C )Relative activity (%)PhyH PhyH-DIIABCDFig. 2. Environmental factors that affect the catalytic activities of PhyH and PhyH-DII. (A) Effect of 0–5.0 mM Ca2+at 37 C. (B) Effect of...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

... indicated in bold, were used according to the proce-dures of the QuickChange site-directed mutagenesis kit(Stratagene, La Jolla, CA, USA): C1 53S-up, 5¢-TGCATCTTGCACTACCAACTCTCTTGCTCCCTTTGTC-3¢; ... forward(NcoI site underlined), 5¢-TGTGACCATGGCCAAGC-3¢;reverse (BamHI site underlined), 5¢-CAAGGATCCCTCACTTC-3¢. The PCR product was digested by NcoI and BamHI restriction enzymes and cloned ... suggestsindeed that cysteines of the active site are the targets of the redox modification. Besides Cys149, whichforms a covalent thioacylenzyme with BPGA during the catalytic cycle, Cys153 is also...
  • 15
  • 515
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "The grapho-phonological system of written French: Statistical analysis and empirical validation" pdf

... grapheme detectors as a function of frequency of occurrence and differences in the strength of the connections between graphemes and phonemes as a function of association probability would then explain ... was a central theoretical assumption of these models compared to connectionist ones. As the DRC model is largely based on the interactive activation principles, the most natural way to account ... restatement of the theory, because it violates the core assumption of the approach, namely, that language users induce all- or-none rules from the language to which they are exposed. Hence, the cost...
  • 7
  • 502
  • 0
Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt

Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt

... but was scarcely degraded in t he absenceATP during 120 min of incubation. On the other hand, nodegradation of MBP was observed either in the presence orin the absence of ATP under the conditions ... bydialysis. The CD spectrum of SulA3±169 showed that the proteinhad a signi®cant amount of secondary structures, and the secondary structure contents were almost identical withthose predicted from the ... puri®ed by successive steps of column chro-matography on phosphocellulose, DEAE-cellulose and Sephacryl S-300 as described previously [1].Correspondence to K. Takahashi, School of Life Science, TokyoUniversity...
  • 7
  • 358
  • 0
Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

... forward,5¢-ACCCCAGCTCAGGGTTTAGGCTTCT-3¢; NFKBIAreverse, 5¢-TGGCTGGGGATTTCTCTGGG-3¢; OPTNforward, 5¢-ACCCGGGTCCCAGCCTCGAC-3¢; OPTNreverse, 5¢-GACAGCCAGCCGCTCCCTGC-3¢; SPI-B for-ward, 5¢-TCCAGCTCCTGTCCCATCTC-3 ... SPI-Brv(5¢-ACTGAAGCTTGGTGGTGCCGGGCGGGCTGT-3¢), and the SacI ⁄ HindIII tailed primers CASP4fw (5¢-ACTACGCGTAGCAAAGAGTGCTGCCTCCTCCTTCCT-3¢) and CASP4rv (5¢-ACTCTCGAGTTCCCTGGTACAGAGCACCT-3¢). The predicted ... generatedby PCR using the MluI ⁄ XhoI tailed primers DARSfw(5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC -3¢) and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCGGCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGACGACCCCAATTCAAATCG-3¢)...
  • 15
  • 500
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... addressesCardiff School of Biosciences, BiomedicalSciences Building, Cardiff, UKàSICIT 2000 S.p.A., Chiampo, Italy§Syngenta Seeds, Enkhuizen, the Netherlands–UMR Ecophysiology and Grape FunctionalGenomics, ... However, the AGC VIII kinases represent a plant-speci c sub-family characterized by a conserved DFD amino acidmotif in subdomain VII of the catalytic domain and by the presence of an amino acid ... interacts with PTI1-1, PTI1-2,PTI1-3 [7] and PTI1-4, future experiments would benecessary to decipher the specificity of action of eachcascade and what mechanisms restrict or regulatecross-talk...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... include control through p53. Cell cycle arrest can be medi-ated by p53 downregulating the transcription of central cell cycle regulators such as cyclin B, Cks1, Cdc2 and Cdc2 5C. CDE ⁄ CHR-dependent ... another reportconfirmed the CDE in the Cdc2 promoter as being dif-ferentially occupied by protein complexes during the cell cycle [9].Mutation of nucleotides close to the CDE in the Cdc2 5C promoter, ... combinedwith the change of protein occupation on the Cdc2 5C CDE, indicates that CDE ⁄ CHR sites which regulatecyclin A, cyclin B and Cdc2 promoters may lose bind-ing of their regulator proteins and repression...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... apoptosis. The mitochondrial release of cytochrome c and second mitochondria-derivedactivator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation ... produced(Fig. 1D, lane 2). In the presence of lactacystin, a sig-nificant increase in the amount of tBid–GFP present in the extract, both in control conditions and in the pres-ence of FLAG–Itch, ... influences the balance between cell survival and apoptosis in normal cell culture conditions.Itch protects cells from tBid-induced apoptosis The cleaved form of Bid, tBid, directly induces cellapoptosis...
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse (nt 1520–1491 PAI-2)SJS174 GCTCACTGCCTAAGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2)SJS175 CTTTATTAGCTACAAAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2)SJS259 CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG Reverse (nt 1585–1552 PAI-2)SJS167 CCTCTTACACTTGCTTTTGAC Forward (nt 455–474 pTETBBB)SJS170 GCAAAGGTGCCTTTGAGGTTG Reverse (nt 897–878 pTETBBB)ALS030 GACCCCTTCATTGACCTCAACTA ... sequence consists of an essential core nonamericsequence, for which the optimal destabilizing activityAB C Fig. 6. The ARE I pentameric sequence can optimize the mRNAdestabilizing activity of the...
  • 14
  • 635
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa họctài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt potbáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxcac tai lieu ngien cuu khoa hoc cua the gioitai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhtai lieu bao cao thuc tap nganh the ducchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui rochuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP