Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans Klaus Brandenburg1, Frauke Wagner1, Mareike Mu¨ ller1, Holger ... Chicester.32. Mu¨hlradt, P.F. & Frisch, M. (1994) Purification and partial bio-chemical characterization of a Mycoplasma fermentans- derivedsubstance that activates macrophages to release nitric oxide,tumor ... confersinterspecies variation of a major surface lipoprotein and a macrophage-activating lipopeptide of Mycoplasma fermentans. Infect. Immunol. 67, 760–771.34. Takeuchi, O., Kaufmann, A. , Grote, K., Kawai, T.,...
- 9
- 665
- 1
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx
... enzymatic characterization of HpSDH demonstrates its activity with kcat of 7.7 s)1 and Km of 0.148 mmtoward shikimate, kcat of 7.1 s)1 and Km of 0.182 mm toward NADP, kcat of 5.2 s)1 and ... determined by Bradford assay using bovine serumalbumin as standard.Enzymatic activity assayThe enzymatic activity of HpSDH was assayed at 25 °Cbymonitoring the reduction of NADP (or NAD) at 340 nm(e340¼ ... increased specificity and antibacterial activity. Experimental proceduresMaterialsH. pylori strains SS1 and ATCC 43504 were obtained from Shanghai Institute of Digestive Disease (Shanghai, China).E....
- 11
- 529
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... GAGGCTAGATACTGCTCGATGTIL-10 forward3 TGATGATTTGGAACCATTATTGAAIL-10 reverse3 CACCTTTTTCCTTCATCTTTTCATb-Actin forward1 ACTACCTCATGAAGATCCTGb-Actin reverse1 TTGCTGATCCACATCTGCTGT7- forward TAATACGACTCACTATAGGGSP6-reverse ... Cloning, characterization and expression analysis of interleukin-10 from the common carp,Cyprinus carpioL.Ram Savan1, Daisuke Igawa2 and Masahiro Sakai21United Graduate School of Agricultural ... study.Cloning and characterization of the carp IL-10 gene A carp cDNA library, produced following stimulation withconcanavalin A and LPS [18], was used to isolate the IL-10gene, employing IL-10-Fw2 and...
- 8
- 584
- 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... some serato a 9- and a 15-kDa band. We could show that the9-kDa band in the tomato extracts reacts with a specificantibody against the LTP from cherry, Pru av 3 and the15-kDa band shows reactivity ... sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For amplification of the long isoform the same 5¢ primers were used, the 3¢specific primer was FF3B: 5¢TTACAAGTCTTGCAAAGGGAAGGAT. For amplification ... 1337Molecular characterization and allergenic activity of Lyc e 2(b-fructofuranosidase), a glycosylated allergen of tomatoSandra Westphal1, Daniel Kolarich2, Kay Foetisch1, Iris Lauer1,...
- 11
- 533
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
... Teruna J. Siahaan3 and Seetharama D. S. Jois11Department of Pharmacy and 2Department of Microbiology, National University of Singapore, Singapore;3Department of Pharmaceutical Chemistry, ... possible pair of structures, and was divided into several conformational families. Theaverage structure was taken from each family and chosenas starting structures for the calculation of correctedinterproton ... upper and lower boundaries of distances from ROE/NOE data and (b) the conformationhad / angles within 30° of the calculated /-values from 3JHNa[28]. The final structures which satisfy most of...
- 14
- 657
- 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberatesreducing ... Double-stranded cDNA was syn-thesized from the mRNA with a cDNA synthesis kit(TaKaRa, Tokyo, Japan) and used as an abalone cDNAlibrary. cDNAs encoding abalone cellulase were amplifiedby PCR from ... RTARAAYTGNCCNGCRTCYTGLP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR...
- 8
- 511
- 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... doi:10.1046/j.1432-1033.2002.03108.xSeveral intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), five gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, ... same way asdescribed for the wild-type cDNA.Data base retrievalData base searches and sequence alignments were carriedout with theENTREZ and BLASTsoftware (National Library of Medicine and...
- 9
- 864
- 0
Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf
... as a substrate, and theabsorbance was measured at 490 nm by using a Spectramaxplate reader and software (Molecular Devices, Sunnyvale,CA, USA). All values were interpolated from either a log-log ... theaverage n molÆmg)1with standard deviations (±) obtained from quantifying and averaging areas under specific peaks from GLCanalysis of four separate samples of LGLB.Identity of fatty acid ... Fatty acid methyl e ster (FAME) analysis, GLC and GLC-MSindicated that the majority of fatty acids contained in Spirochaetaaurantia LGLBare either branched or unsaturated. Values stated a...
- 11
- 632
- 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: pectenotoxins, unusual macrolides that disrupt actin pptx
... established, on the basis of morphological changes, reduction of mitochondrialmembrane potential, increases in cytoplasmic cyto-chrome c and Smac ⁄ DIABLO, and caspase-3 and caspase-9 activation. ... MINIREVIEWMarine toxins and the cytoskeleton: pectenotoxins,unusual macrolides that disrupt actinBegon˜ a Espin˜ a 1 and Juan A. Rubiolo1,21 Departamento de Farmacologia, Facultad de Veterinaria, ... such as angiogenesis, cell adhesion,cytokinesis and metastasis has made it an attractivetarget for the development of anticancer drugs. Drugsthat block the regulation of actin filament dynamicswithin...
- 7
- 507
- 0
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf
... factor 1 homeodomain – hints from 15N-NMRrelaxation studiesDevrim Gu¨mral, Luana Nadalin, Alessandra Corazza, Federico Fogolari, Giuseppe Damante,Paolo Viglino and Gennaro EspositoDipartimento ... experimental R1 and R2data was assessed by measurement duplication over a series of arbitrarily selected relaxation delays (at least three;see supplementary Doc. S1). The average uncertaintiesobtained ... diversity of R1 and R2estimations for a dilute sample at low temper-ature. Analogously to the relaxation rates, the NOE dataerrors were also estimated by duplicated measurements and were analyzed...
- 14
- 744
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ