Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia C. Vijayasarathy1,*,†, ... though the catalytic efficiency of the enzyme (TN for cytochrome c oxidase) remainednearly the same. Increased glycolytic flux and alterations in the kinetic characteristics of the CytOX might be the ... USA The effects of physiologically relevant hypoxia on the catalytic activity of cytochrome c oxidase (CytOX), mito-chondrial gene expression, and both nuclear and mito-chondrial encoded CytOX...
- 9
- 554
- 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf
... toxinis cleaved by furin into two fragments: the A chaincorresponding to the catalytic domain (C domain); and the B chain corresponding to the translocationdomain (T domain) and the receptor-binding ... The acidic pH in the endo-some triggers a conformational change, leading toinsertion of the toxin in the membrane. The C domainis then translocated across the endosomal membraneinto the cytosol. ... receptor-binding domain. The C and T domains remain covalently linked by adisulfide bond. Following binding to its cell-surfacereceptor, diphtheria toxin is internalized through the clathrin-coated...
- 10
- 530
- 0
Tài liệu Báo cáo khoa học: "Adaptive String Distance Measures for Bilingual Dialect Lexicon Induction" pdf
... a training lex-icon consisting of correct word pairs. The initialtransducer contains uniform probabilities. It is usedto transduce the word pairs of the training lexicon,thereby counting all ... that these two tech-niques can be combined efficiently. They use Rapp’sco-occurrence vectors in combination with Mann and Yarowsky’s EM-trained transducer.3 Two-Stage Models of Lexical InductionFollowing ... (insertion of one character, substitution of onecharacter by another, and deletion of one character)have a fixed cost of 1. The identity operation (keep-ing one character from the source word in the...
- 6
- 388
- 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
... yieldsthree fractions which are denoted according to the proteinsthey contain. Fraction 1 includes all ‘non -nuclear proteins’,i.e. cytosolic proteins separated during hypotonic prepar-ation of nuclei, ... doi:10.1046/j.1432-1033.2003.03769.xfunctional complex, indicating a speci c in uence of O2-dependent cellular changes on critical steps of the assembly of a functional viral replication machinery.Consequently, we ... nucleosolic proteins. The remaining pellet contains all DNA and structure boundproteins and is further referred to as chromatin-fraction.Electrophoresis of proteins and Western blottingCytosolic and...
- 11
- 610
- 0
Tài liệu Báo cáo khoa học: "Adaptive Natural Language Interaction" potx
... forthat description (e.g., about the monument’s ar-chitect) are dynamically included in the rules of the speech recognizer’s grammar, to increase wordrecognition accuracy. The rules include compo-nents ... generated descriptions vary dynamically, in both content and language expressions, dependingon the interaction profile as well as the dynamicinteraction history. The dynamic preference factor of the ... (exhibiting system personality and adapting to user background and interests).3 System Description The system is capable of interacting in a vari-ety of modalities, including non-verbal ones suchas...
- 4
- 303
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... for introduction of unmarkedmutations in the genome of Paracoccus denitrificans –construction of strains with multiple mutations in the genes encoding periplasmic cytochrome- C 550, cyto-chrome -C 551, ... cytochrome cd1, is necessary for the biogenesis of the d1cofactor[9–13]. In P. denitrificans and closely related Para-coccus pantotrophus, these genes are cotranscribed asKeywords cytochrome cd1; ... nirC gene encodes a periplasmic c type cyto-chrome that may have an electron transfer role in cyto-chrome cd1 activity [16] or maturation [15].Conflicting evidence exists concerning the subcellularlocation...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx
... Cell-cycle regulation is important in growthcontrol, and therefore deregulation of the cell-cyclemachinery has been implicated in carcinogenesis [57].Cyclins and cyclin-dependent kinases (CDKs), ... up-regulation of CDK inhib-itors, including KIP family members and INK4 family members Members of the KIPfamily can inhibit the catalytic activity of CDK2, 4 and 6 Members of the INK4 familyare speci c ... by gefitinib or erlotinib in intestinalepithelial cells [53]. Furthermore, the expression of cIAP-1 and of X-linked IAP is reduced by AG1478 in squamous cell carcinoma cell lines NA and Ca9-22[54]....
- 11
- 611
- 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce ahexahistidine tag and a ClaI ... (FWN1:5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATAC-3¢),designed to introduce a ClaI restriction site at nucleotideposition –6 and a reverse primer (REVN1:5¢-CCTGCCATTGCTTGCAGCC-3¢) that introduced ... restriction site at nucleotideposition –6 and a reverse primer (5 ¢-A TCGCCATGGTCCCGGGCATATGGGATCCCTGGAAGTACAGGTTTTCGCCATGCTCTTGATCCC-3¢) designed to remove the stop codon and to introduce a...
- 14
- 672
- 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf
... oligonucleotide (GL70, 5¢-bio-tin-CTC CAG TGA ATC CCA GAA GAC TCT GGAG-3¢; GL70mt, 5¢-biotin-CTC CAG TAG ATC TCA AGAGAC TCT GGA G-3¢) in binding buffer [50 mm Tris ⁄ HCl,pH 7.8, 100 mm NaCl, ... )272 and )13 (forward, 5¢-CCA TGG AGACCA ACA CCC T-3¢; reverse, 5¢-CCC TGG GCT TTTATA AGT CGT-3¢), or the human hsp70 gene between)1860 and ) 656 (forward, 5¢-TCT ATC TCT CGA TGGATA CAG A-3¢; ... C- terminal 173 aminoacids of Hsp105b, failed to induce luciferase activity. As Hsp105b(D642–698), which lacked the regionbetween amino acids 642 and 698, also failed to induce the luciferase activity, ...
- 11
- 584
- 0
Tài liệu Báo cáo khoa học: High-affinity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx
... respectively. The lines in each graph (E, F) indicate the amount of binding predicted if the wild-type and mutant receptorsare binding ligand independently. The tables indicate the amounts of the ... at 4 C. The lines in each graph (F, G) indicate the amount of binding predicted if the wild-type and mutant receptorsare binding ligand independently. The tables indicate the amounts of the various ... ligand, collected by centrifuga-tion, and counted in a c- counter. Speci c [125I]IGF-II bind-ing was determined by subtracting c. p.m. ligand bound in replicate reactions carried out in the...
- 15
- 486
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI