Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... insects. Annu Rev Entomol 51,1–24.7 Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY& Ishizaki H (1986) Amino acid sequence of a protho-racicotropic ... concentrated the ELISA-positive material into a peak so sharp that we judgedthat sufficient purification had been achieved.Determination of the structure of 8K-BLPMALDI-TOF MS analysis of the purified ... insects, the basal external structure of adult appendages such as wings, legs and antennaehave already been built at the time of pupation,although they are still very immature. The imaginaldisks...

Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural speciﬁcity variants doc

... further decrease the stability of the canavany-lated species. The role of tRNA as a cofactor for aminoacylationin those aminoacyl-tRNA synthetases that requiretRNA for amino acid activation is ... amino acid utilization by the plant arginyl-tRNA synthetases. The aminoacylation level attained in the pres-ence of L-arginine was compared to that in the presence of 1 mM of the analogue indicated, ... enzymereveals a discriminatory ability that has characteristicsapproaching those of the jack bean enzyme.In view of the distinct role of conformational changesthat accompany the catalytic cycle of the...

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... CGATTTGCTGACCACCTTCTMLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATCMLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAAMLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTGMLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTGHOXC13-ERE1 ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACCERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTCTGCCACTTCCCGCTCA a MLL3 antisense CCATCTGTTCCTTCCACTCCC a MLL4 ... AGTCTGCATCCCCGTATTTGHOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCCHOXC13-ERE2 TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGATHOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAAHOXC13-ERE4 TGCCCTCATATAAACCTGGAA...

Tài liệu Báo cáo khoa học: "Using Smaller Constituents Rather Than Sentences in Active Learning for Japanese Dependency Parsing" docx

... annotators label examples. Assume thatwe have an annotator and the learner selects somebunsetsu pair of the j-th bunsetsu and the i-th bun-setsu such that j < i. The annotator is then askedwhat ... simplicity.6.3 FeaturesThere are features that have been commonly usedfor Japanese dependency parsing among relatedpapers, e.g., (Kudo and Matsumoto, 2002; Sas-sano, 2004; Iwatate et al., 2008). We also ... with machine learning-based classi-ﬁers. There are many algorithms that have such a framework, which include (Yamada and Mat-sumoto, 2003) for English and (Kudo and Mat-sumoto, 2002; Iwatate...

Tài liệu Báo cáo khoa học: "Mining User Reviews: from Speciﬁcation to Summarization Xinfan Meng Key Laboratory of Computational Linguistics " doc

... several hundredfeatures.Then we r un our algorithm on the data and eval-uate the precision and recall. We also run the al-gorithms described in Hu and Liu (200 4a) on the same data as the baseline.From ... vocabu-lary of product features. Hierarchy struc-ture information and unit of measurementinformation are mined from the speciﬁ-cation to improve the accuracy of featureextraction. At summary ... et al. (2005) bothadopt a tree map visualization to display featuresand sentiments associated with features.We adopt a relatively simple method to generate a summary. We do not predict the...

Tài liệu Báo cáo khoa học: "Mining metalinguistic activity in corpora to create lexical resources using Information Extraction techniques: the MOP system" doc

... self-referential lexical items that are the logical or grammatical subject of a predication that needs not be a complete grammatical sentence. 3 At a very basic semiotic level natural language has ... extraction of metalinguistic information from technical and scientific documents. We claim that such a system can create special databases to boot-strap compilation and facilitate update of the ... information available to an average, idealized speaker). A Metalinguistic Information Database (MID), on the other hand, compiles the real-time data provided by metalan-guage analysis of leading-edge...

Tài liệu Báo cáo khoa học: Probing the molecular determinants of aniline dioxygenase substrate speciﬁcity by saturation mutagenesis docx

... deletedPlasmids transformed intoE. coli BL21(DE3)Activityagainst 2MAatdA1 pACYC A2 and pET A3 A 4A5 –atdA2 pACYC A1 and pET A3 A 4A5 +atdA3 pACYC A1 A2 and pET A4 A5 –Control (no deletion) pACYC A1 A2 ... of AtdA3, the largest substrate accepted by the WT AtdA, 2EA, wasdocked into the AtdA3 homology model. The approxi-mate initial position of the substrate was determinedon the basis of the possible ... substrates, 24DMA and 3,4-dimethylanilineFig. 1. Putative aniline dioxygenation pathway of AtdA. Oxygen atoms are incorporated by AtdA into the 1 and 2 positions of the aniline aro-matic ring...

Tài liệu Báo cáo khoa học: nsights into the reaction mechanism of glycosyl hydrolase family 49 Site-directed mutagenesis and substrate preference of isopullulanase doc

... CCGGTGGTcGAcTTTGGTTtcACGCCCSalIE273Q ACGTACTGCTgTCCGGAAAGtACtCCATGGCCGCScaID353N TCCAATCCGTtAGTCTGgCCaTAGAACGCGCMscIE356Q GGAGAATGGTgCCAGGGTACATTTcCAATCCGTCAKpnID372N AATACATCTTaAGGCCGTCGTtGTCGGTGTGG A IID373N ... gnition sites ( u nderlined).Pimers Nucleotide sequence (5¢ﬁ3¢)W31F CTGACCTtcTGGCATAACACCGGtGAAATCAgeIW32F CCTGGTtcCATAACACCGGtGAAATCAgeIW240F GGTGCTgAGCTCAAGTGTGACTTtcGTCTACSacIW402F ... N-terminal and b-he licaldomains participate in binding of the polysaccharide,pullulan.Comparison of the active sites of the model of IPUand Dex4 9A The active site structures of t he model of...

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala3K > Q K37Q F ggtgcgtcgatccaaggctttcaacaagcaatgag ... AlaF9 4A F9 4A F caggtgtgggcagctatcgccccagcgc Phe94 to AlaP9 7A P9 7A F ggcatttatcgccgctgcgctgtataagcatg Pro97 to AlaL9 9A L9 9A F cgccccagcggcgtataagcatgaacgtcg Leu99 to Ala E10 3Q E10 3Q F gctgtataagcatcagcgtcgcctggtggtg ... II.Export assays using these mutants are shown inFig. 4A. The data show that all three TatB mutantsTatATatATatBTatCTatATatBTatCpBAD-ABCspBAD-ABCs2R>NK2 4A K2 4A K2 4A K2 4A K2 4A 3K>Q3K>Q3K>Q3K>Q3K>Q3K>Q/2R>N2R>N3K>Q3K>Q3K>Q3K>Q2R>N...

Tài liệu Báo cáo khoa học: Identiﬁcation of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... data were captured using a FujiLAS-1000 Imaging System CCD camera (aida 2.11 soft-ware for analysis).ACE2 ⁄ ACE activity assaysFluorogenic assays using the synthetic ACE2 substrate,Mca-APK(Dnp) ... that the ACE residue His1089, shown to be involved in the Fig. 1. Schematic view of the active site of ACE2 and tACE.Binding interactions of the inhibitor (A) MLN-4760 at the active site of ACE2 ... byACE2 and other zinc proteases, e.g. ACE. Our muta-genesis data therefore provide additional critical infor-mation over that obtained from X-ray data alone. The knowledge gained from these mutagenesis...

Xem thêm