Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberatesreducing ... Double-stranded cDNA was syn-thesized from the mRNA with a cDNA synthesis kit(TaKaRa, Tokyo, Japan) and used as an abalone cDNA library. cDNAs encoding abalone cellulase were amplifiedby PCR from ... Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai Ken-ichi Suzuki, Takao Ojima and Kiyoyoshi NishitaLaboratory of Biochemistry and Biotechnology, Graduate School...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but ... D-amino acid in peptide link-age by an enzyme from frog skin secretions. Proc NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama ... crosspeaks were assigned and inte-grated, with concomitant cycles of structure calcula-tions for evaluation of distance and angle constraintviolations as well as assignments of additional peaksbased...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... temperature until all free waterwas evaporated. After this, IR spectra were recorded atroom temperature and at 37 °C. Usually, the originalspectra were evaluated directly and a spectral analysis ... Chicester.32. Mu¨hlradt, P.F. & Frisch, M. (1994) Puriﬁcation and partial bio-chemical characterization of a Mycoplasma fermentans-derivedsubstance that activates macrophages to release nitric oxide,tumor ... Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentansKlaus Brandenburg1, Frauke Wagner1, Mareike Mu¨ ller1, Holger Heine1,Jo¨ rg Andra¨1,...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... primers; CLGAT 5a (5¢-GGCATCAACAT-CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT-CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) and CLGAT3b(5¢-AAGGGAGAGAAACCTGACCTTGCACTTG-3¢). ... watermelonKentaro Takahara, Kinya Akashi and Akiho YokotaGraduate School of Biological Sciences, Nara Institute of Science and Technology, JapanDrought in the presence of strong light is a ... N-acetylglutamate kinase; AGPR,N-acetylglutamate 5-phosphate reductase; AOAT, N-acetylornithinetransaminase; GAT, glutamate N-acetyltransferase; AOD, N-acetyl-ornithine deacetylase; OCT, ornithine carbamoyltransferase;...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crabParatelphusa jacquemontiiMaghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. ... sialidasetypeX,proteaseenzymes and molecular mass standards were purchased from Sigma.Preparation of crab seraFreshwater field crabs, Paratelphusa jacquemontii werecollected from the local ... [34]. An evaluation of the literature revealed that purification of lectin from thehemolymph of crustaceans was most successful by affinitychromatography as it gave a higher fold of purification and percentage...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... with anapparent molecular mass of 53 kDa appears as a double band inunboiled samples (lanes A1 and B1).Table 1. N-Terminal sequences of the polypeptides of the puriﬁed enzyme. N-Terminal sequen ... of AF499 was identiﬁed asan archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence()35 to )23, AAANNNTTATATA) ... catalyticsubunit of Hdr from methanogenic archaea have beendeposited in the databases. None of these putative pro teinshas b een c haracterized and no f unction has been assigned toany of...

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... enzymatic characterization of HpSDH demonstrates its activity with kcat of 7.7 s)1 and Km of 0.148 mmtoward shikimate, kcat of 7.1 s)1 and Km of 0.182 mm toward NADP, kcat of 5.2 s)1 and ... 2-({2-[(2-{[2-(2,3-dimethylanilino)-2-oxoethyl]sulfanyl}-1,3-benzo-thiazol-6-yl)amino]-2-oxoethyl}sulfanyl)-N-(2-naphthyl)acetamide (4) and maesaquinone diacetate (5) wereTable 1. Comparison of kinetic parameters of SDH enzymes from various bacteria. a Kinetic parameters for M. tuberculosis SDH are from ... can oxidize shiki-mate using NAD as cofactor, which has a kcat of 5.2 ± 0.1 s)1 and Km of 2.9 ± 0.4 mm toward NAD.HpSDH shows a 10 times higher Kmfor NAD thanfor NADP at saturation of...

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of ﬂavonol synthase from Citrus unshiu pptx

... doi:10.1046/j.1432-1033.2002.03108.xSeveral intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... same way asdescribed for the wild-type cDNA. Data base retrievalData base searches and sequence alignments were carriedout with theENTREZ and BLASTsoftware (National Library of Medicine and ... Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ﬁve gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum,...

Báo cáo khóa học: Puriﬁcation and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... sense(VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAAATC-3¢) and vector antisense (VA) (5¢-CCGCTCGAGCTTCATAGAAATAGTCGCCTC-3¢)primerswascloned into NdeIandXhoI sites of pET22b(+) vector(Novagen). The BL21[DE3]pLysS ... Koichiro Komai and Kazuhiko MatsudaDepartment of Agricultural Chemistry, Faculty of Agriculture, Kinki University, Nara, JapanBacillus cereus isolated from the larvae of Myrmeleon borewas found ... Plus polymerase, the primers (forward primer,5¢-CAAATGGAGGTATGGAACG-3¢; reverse primer,5¢-GCACAAGGTAATGGAACTTC-3¢), 1 mMMgSO4,0.2 mMdNTP and 100 ng genomic DNA as templateaccording to...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 ... CGAGCAGGAGATGGGAACC Real-time PCRZfbactin-R CAACGGAAACGCTCATTGC Real-time PCRZfgapdh-F CGCTGGCATCTCCCTCAA Real-time PCRZfgapdh-R TCAGCAACACGATGGCTGTAG Real-time PCRZFil4-F CATCCAGAGTGTGAATGGGA ... CTGCTTTTCTGGGGACTTCA Initial PCRZf3¢foxp3-F1 TGAAGTCCCCAGAAAAGCAG 3¢-RACEZf3¢foxp3-F2 GTGCTTTGTGCGTGTTGAAG 3¢-RACEZf5¢foxp3-R1 TGTATGATGGAAAAGGTGGCA 5¢-RACEZf5¢foxp3-R2 GGAACACACAGAGGGGATGATA 5¢-RACEOligo...

Xem thêm