Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx
Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx
... ABSTRACT In natural language processing, ambiguity res- olution is a central issue, and can be regarded as a preference assignment problem. In this paper, a Generalized Probabilistic Semantic ... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... from a semantic representation. In general, a particular interpretation of a sentence can be represented by an annotated syntax tree (AST), which is a syntax tree annotated with fea- ture...
- 8
- 412
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... integrate a language -model- based classifier approach with a Markov-transition model to exploit three kinds of in-formation (i.e., contextual, response, and friendship information) for sentiment ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format. Conceptually, ... In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme...
- 6
- 449
- 0
Tài liệu Báo cáo khoa học: "Smoothing a Tera-word Language Model" doc
... Dirichlet FormMacKay and Peto (1995) show that based on Dirich-let priors a reasonable form for a smoothed distribu-tion can be expressed asα(c|ab) =C(abc)C(ab∗) + A (8)γ(ab) = A C(ab∗) + A The ... rea-sonable alternative is to take A to be proportionalto the missing count due to low-count n-grams:C(ab) − C(ab∗). A( ab) = max(1, K(C(ab) − C(ab∗))) A different K constant is chosen for each ... Universitydyuret@ku.edu.trAbstractFrequency counts from very large corpora,such as the Web 1T dataset, have recently be-come available for language modeling. Omis-sion of low frequency n-gram counts is a prac-tical...
- 4
- 425
- 1
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive relationship ... that a dedicated discourse marker lexi- con holding this kind of information can serve as a valuable resource for natural language pro- cessing. Our efforts in constructing that lexicon are...
- 5
- 528
- 0
Tài liệu Báo cáo khoa học: "Exploiting Syntactic and Shallow Semantic Kernels for Question/Answer Classification" docx
... can be used to design a shallow semantic representation that can be matched againstother semantically similar sentences, e.g. [ARG0Researchers] [r eldescribe] [ARG1antigens][ARG2as foreign ... suggest that syntactic informationhelps tasks such as question/answer classifi-cation and that shallow semantics gives re-markable contribution when a reliable set ofPASs can be extracted, e.g. ... design ofaccurate automatic Semantic Role Labeling (SRL)systems (Carreras and M`arquez, 2005). Attemptingan application of SRL to QA hence seems natural,as pinpointing the answer to a question...
- 8
- 456
- 0
Tài liệu Báo cáo khoa học: "Deriving Verbal and Compositional Lexical Aspect for NLP Applications" pptx
... say, alphabetically. 6 Aspectual Feature Determination for Composed LCS's Modifications described above reveal similarities be- tween verbs that carry a lexical aspect, feature as part ... sentential levels. Finally, we illustrate how access to lexical aspect facilitates lexical selection and the interpretation of events in machine transla- tion and foreign language tutoring applications, ... and Rappaport Hovav (To appear) demonstrate that limiting composition to aspectu- ally described structures is an important part of an account of how verbal meanings are built up, and what...
- 8
- 401
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles). The GAPDH-specific...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... 447–453.19 Oliveira PH, Batagov A, Ward J, Baganz F & KrabbenP (2006) Identification of erythrobactin, a hydroxamate-type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... 40760–40767.34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S(1999) TRAIL causes cleavage of bid by caspase-8 andloss of mitochondrial membrane potential resulting inapoptosis in BJAB cells. ... Monoclonal antibody against PARP (C2-10)was obtained from Trevigen (Gaithersburg, MD, USA).Antibodies against 4E-BP1 and a- tubulin were obtainedfrom Santa Cruz Biotechnology (Santa Cruz, CA, USA)and...
- 11
- 679
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ