Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf
Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf
... inheritance& apos; in which direct inheritance is allowed from only one superclass at a time. The main advantage that multiple inheritance offers over simple inheritance is the ability to inherit ... of class definitions. In equs. tions, unification variables have initial capitals, and negation of constants is indicated by ' '. 'kk' is the string concatenation operator ... to alternatives at the same conceptual level in the hiersrchy, and in msny cases reflect the tra- ditional ides of 'paradigm'. Equations within a variant set are absolute constraints,...
- 7
- 362
- 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf
... opinions? Finally, approaches to opi-nion mining have implicitly assumed that the prob-lem at stake is a balanced classification problem, based on the general assumption that positive and negative ... identifying the most rele-vant challenges in mining opinions targeting media personalities, namely politicians, in comments posted by users to online news articles. We are interested in answering ... mentions are classifiable into syntactic-semantic categories; (vi) the opinionated sentences may be characterized according to their polarity 565and intensity; (vii) each opinionated sentence may...
- 5
- 499
- 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
... (Manning and Schütze,1999). Multidimensional scaling is data analysistechnique that provides a spatial display of the datarevealing relationships between the instances in thedata set (Davison, ... multidi-mensional scaling. The analyses showed that resultsobtained using aggregate analysis of word pronunci-ations mostly conform with the traditional phoneticclassification of Bulgarian dialects as ... that 3 factors are most im-portant, explaining 35% of the total amount of vari-ance. The main drawback of applying this technique in dialectometry is that it is not directly related to theaggregate...
- 6
- 651
- 0
Tài liệu Báo cáo khoa học: "Mapping Lexical Entries in a Verbs Database to WordNet Senses" doc
... (WSD) in several ways. First, thewords to be disambiguated are entries in a lexicaldatabase, not tokens in a text corpus. Second, wetake an “all-words”rather than a “lexical-sample”approach ... Sim-pleProd, and SimpleWtdSumMajSgl+Aggr: Majority vote of MajSim-pleSgl and MajAggrMajPair+Aggr: Majority vote of MajSim-plePair and MajAggrTable 2 gives recall and precision measures forall variations ... variations at their optimal votethresholds. In the AutoMap+ variation, Grid and Levin+probabilities abstain from voting when their val-ues are zero (a common occurrence, becauseof data sparsity...
- 8
- 415
- 0
Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx
... viewneutral mapping adjuncts (VNMAs)1. We regardVNMAs as standard but implicit default aspectsof all view-specific metaphorical mappings. Theyare defaults in that they can, in principle, ... SPACEand IDEAS ARE PHYSICAL OBJECTS, con-taining the following relevant mappings:When a person's mind is being viewed as a physical space, an idea's being physically located in the space ... wecall View Neutral Mapping Adjuncts(VNMAs). We give a list of the mainVNMAs that appear to be required, andshow how they can be incorporated into a pre-existing system (ATT-Meta) formetaphorical...
- 6
- 455
- 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt
... caused by using a planttranslation system, in which mammalian mRNA wasinappropriately translated. The transient expressionassay indicated that M33S and isoform 1 proteinswere secreted into the ... Mountain View, CA) was used as a template, because this organ abundantly expresses mRNAfor both isoforms 1 and 2. Oligo cap RACE was performedusing a Gene racer kit (Invitrogen, Carlsbad, CA), accord-ing ... 5¢-AGGAACCAAACACCAAGTGG-3¢(Fig. 2A) .Luciferase promoter assayHuman genomic DNA was isolated from two volunteers(both male, Japanese, aged 34 and 37 years) after they gaveinformed consent. A 1460...
- 9
- 544
- 0
Tài liệu Báo cáo khoa học: Multiple enzymic activities of human milk lactoferrin ppt
... only in half of 14 analyzed milk samples. A similarsituation was observed after separation of human milkproteins in a gel containing RNA; again LF was signifi-cantly more active in hydrolysing ... GGCACTTAC,TAGAAGATCAAA, and ACTACACATCTACA, corres-ponding to sequences to which it is known to bindand activate transcription [10], as well as different d(pN)10with comparable Kmvalues ... maximal activity was taken as100% and the activity of other subfractions was calculated as a percentage of that with maximal activity. Zero indicates the absence of any activity in the subfraction...
- 9
- 494
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... is insufficient to accuratelyexplain insulin-stimulated changes in the concentration of intracellularspecies and partitioning of glucosedisposal in skeletal muscle. Insulinpropagates a rather ... only activity able to convertpyruvate into acetyl-CoA. Tworedundant pathways for acetateassimilation are needed as a resultof a coupling between the TCA cycleand acetate activation to acetyl-CoAby ... activator of tran-scription, mitogen-activated protein kinase; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; MCF, macrophare chemotactic factor; MCIP, modulatory calcineurin-interact-ing...
- 91
- 733
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ