0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "Pseudo-Projectivity: A Polynomially Parsable Non-Projective Dependency Grammar" docx

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Online Large-Margin Training of Dependency Parsers" docx

... Crammer et al. (2003). Unlike the SVMparser of Yamada and Matsumoto (2003) and Ratna-parkhi’s parser, our parsers are trained to maximizethe accuracy of the overall tree.Our approach is related ... per-forms as well or better than previous comparablesystems, including that of Yamada and Matsumoto(2003). Their method has the potential advantagethat SVM batch training takes into account all ... than that of Yamada and Mat-sumoto (2003).We present a new approach to training depen-dency parsers, based on the online large-marginlearning algorithms of Crammer and Singer (2003)and Crammer...
  • 8
  • 443
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ forTMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-specific...
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... 447–453.19 Oliveira PH, Batagov A, Ward J, Baganz F & KrabbenP (2006) Identification of erythrobactin, a hydroxamate-type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol...
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... a heat block,and allowed to anneal until the block temperature haddecreased to room temperature.Assay procedureThe assay was run as a three-step assay: initial incubation ofthe sample and...
  • 9
  • 457
  • 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... 40760–40767.34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S(1999) TRAIL causes cleavage of bid by caspase-8 andloss of mitochondrial membrane potential resulting inapoptosis in BJAB cells. ... combination of IFNa and TRAIL,relative to TRAIL alone.In view of the cleavage of caspase substrates such asBID and PARP, the effect of IFNa and TRAIL onthe DNA content of MCF-7 cells was also assessed,using...
  • 11
  • 679
  • 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also amplified using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...
  • 11
  • 566
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed andquantified on a Fuji Bio-Imaging analyzer BAS-2500 usingIMAGE GAUGEV3.3 software.Chromatin and protein–DNA analysisMicrococcal nuclease (MNase) digestion and in situ cleavageby ... Biotechnology) and acetylated H3 (Upstate Bio-technology), and antibodies against specific modificationssuch as acetylated H3-K9 (Cell Signaling Technology) andH3-K14 (Abcam) and anti-H3 C-terminal (Abcam). ... yeast. Proc. Natl Acad. Sci. USA 97, 13708–13713.52. Rascle, A. , Johnston, J .A. & Amati, B. (2003) Deacetylase activityis required for recruitment of the basal transcription machineryand...
  • 10
  • 500
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... corpusRyo NagataKonan University8-9-1 Okamoto,Kobe 658-0072 Japanrnagata @ konan-u.ac.jp.Edward Whittaker Vera SheinmanThe Japan Institute forEducational Measurement Inc.3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004;Nagata et al., 2005; Nagata et al., 2006; Tetreault etal., 2010b). This is one of the most active researchareas in natural language processing of learner ... NorthAmerican Chapter of the ACL, pages 154–162.Joel Tetreault, Elena Filatova, and Martin Chodorow.201 0a. Rethinking grammatical error annotation andevaluation with the Amazon Mechanical Turk....
  • 10
  • 467
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum-marization framework as well as a novel audiovis-ual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme...
  • 6
  • 449
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... each paid reward.• Qualifications To improve the data quality, a HIT can also be attached to certain tests,“qualifications” that are either system-providedor created by the requester. An example ... the assign-ments have been completed.• Rewards At upload time, each HIT has to beassigned a fixed reward, that cannot be changedlater. Minimum reward is $0.01. Amazon.comcollects a 10% (or a ... excess of information. FAQ-pages tend to alsoanswer questions which are not asked, and also con-tain practical examples. Human-powered answersoften contain unrelated information and discourse-like...
  • 9
  • 610
  • 1

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ