Tài liệu Báo cáo khoa học: "Opinion and Generic Question Answering Systems: a Performance Analysis" ppt
Tài liệu Báo cáo khoa học: "Opinion and Generic Question Answering Systems: a Performance Analysis" ppt
... the ACL-IJCNLP 2009 Conference Short Papers, pages 157–160,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLPOpinion and Generic Question Answering Systems: a Performance Analysis Alexandra ... evaluation and comparison of two different approaches to QA a fact-oriented one and another designed for opinion QA scenarios. Related work Research in building factoid QA systems has a long ... involved in a mixed fact and opinion question answering setting by comparing the perform-ance of two Question Answering (QA) sys-tems as far as mixed opinion and factual set-ting is concerned....
- 4
- 278
- 0
Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx
... and SKC) and a fragment consisting of SKdomains B and C (SKBC) at pH 7.0. The data for SKAat pH 7.0 and 0.88 mgÆmL)1have been taken fromAzuaga et al. [19]. Fragments SKA, SKB and SKC showsingle ... reversiblebecause state A ncan dissociate and unfold at hightemperatures. Nevertheless, association and dissociationcan be slow at certain temperatures and therefore kineticallycontrolled. Constants ... Pedro L. Mateo1 and Francisco Conejero-Lara11Departamento de Quı´mica Fı´sica e Instituto de Biotecnologı´ a, Facultad de Ciencias, Universidad de Granada, Granada, Spain;2Oxford Centre...
- 13
- 503
- 0
Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt
... differ-ent patent classes and different patent textsections such as title, abstract, and claims,as separate translation tasks, and investi-gate the influence of such tasks on machinetranslation performance. ... Other ap-proaches have extracted parallel data from similaror comparable corpora (Zhao et al., 2004; Snoveret al., 2008). Several approaches have been pre-sented that train separate translation ... error rate training for patent translation.3 Extraction of a parallel patent corpusfrom comparable dataOur work on patent translation is based on theMAREC3patent data corpus. MAREC con-tains...
- 11
- 436
- 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... (ischemia) of key metaboliteconcentrations and metabolic fluxes,both measured and nonmeasured. A general parameter sensitivityanalysis is carried out to determine and characterize the parametershaving ... then glycerol, and finally acetateLogic sim NG NG Single time points of fluxes and mRNA measuredby microarraysAsenjo AJ, RamirezP, Rapaport I,Aracena J, Goles E& Andrews BA(2007) J MicrobiolBiotechnol ... Simulating, Analyzing, and Animating Dynamical Systems: A Guide to XPPAUTfor Researchers and Students. SIAM, Philadelphia, PA.43 Hoops S, Sahle S, Gauges R, Lee C, Pahle J, SimusN, Singhal M,...
- 91
- 733
- 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
... might acetylate activegenes in association with the elongating Pol II. Inaddition to yeast SAGA and NuA4, the mammalianHAT HBO1 is also potentially able to be recruited to and to acetylate H4 ... [85]. Mast cells express GATA-2 as well asNFAT and AP-1, and GATA-2 initiates the formationof an additional discrete GATA-2 ⁄ AP-1 enhanceo-some-like complex existing upstream of the two NFA-T ... 1019–1031.131 Sharma GG, So S, Gupta A, Kumar R, Cayrou C,Avvakumov N, Bhadra U, Pandita RK, Porteus MH,Chen DJ et al. (2010) MOF and histone H4 acetyla-tion at lysine 16 are critical for DNA damage responseand...
- 29
- 743
- 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a 3´ CGAGUAGUUUCGACCGACACUAUdme-miR-2b ... UTR 5´ AUUGUUUUAUCUUAUCAGUAUUA ||| ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCC-GUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUsite 2: ZEB1 3´ UTR 5´ AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b ... AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1, 2 5´ CAUGUAAGUGCUUAAAUAAGCUA...
- 9
- 684
- 0
Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc
... Hoffman AE, Zheng T, Yi C, Leaderer D, Weidhaas J,Slack F, Zhang Y, Paranjape T & Zhu Y (2009) micr-oRNA miR-19 6a- 2 and breast cancer: a genetic and epi-genetic association study and functional ... matlab, version 201 1a (Mathworks, Natick, MA,USA), we compared localization and strand directionbetween miRNAs and transcripts (Refseq genes and mRNAs). Intragenic and intergenic miRNAs were definedby ... et al. (2004) Human microRNA genes arefrequently located at fragile sites and genomic regionsinvolved in cancers. Proc Natl Acad Sci USA 101,2999–3004.57 Takamizawa J, Konishi H, Yanagisawa...
- 12
- 636
- 0
Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt
... reticulumjunction, and are activated by membrane depolariza-tion. IcaLis important in heart function because itmodulates action potential shape and contributes topacemaker activities in the sinoatrial and ... 1944–1949.66 D’Alessandra Y, Devanna P, Limana F, Straino S, DiCarlo A, Brambilla PG, Rubino M, Carena MC,Spazzafumo L, De Simone M et al. (2010) CirculatingmicroRNAs are new and sensitive biomarkers ... the heart, and may be a potential anti-ar-rythmic target.Angiogenesis and vascular diseasesRecently, a few specific miRNAs that regulate endo-thelial cell functions and angiogenesis have beendescribed....
- 15
- 684
- 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department ... nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank underaccession numbers 2xog and 2xoiAbbreviationsPDB, Protein Data Bank; ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...
- 9
- 626
- 0
Từ khóa: opinion and generic question answering systemstài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khichuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ