0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder An Interface System for Recording a Corpus of Speech for Synthesis" ppt

... polikoff}@asel.udel.edu Abstract We will demonstrate the ModelTalker Voice Recorder (MT Voice Recorder) an interface system that lets individuals record and bank a speech database for ... rerecord an unacceptable utterance. Recordings are automatically labeled and saved and a speech database is created from these recordings. The system s intention is to make the process of recording ... by a profes-sional speaker and manually polished, all other voices were created by untrained individuals, most of whom have ALS, in an untrained setting, with the recordings having no manual...
  • 4
  • 419
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... (Kurohashi and Na-gao, 1994) or CaboCha (Kudo and Matsumoto,2002). Although this information is less accu-rate than manually annotated information, theseautomatic analyzers provide a large amount ... trainingdata)1.RerankingCandidate 1Candidate 2Candidate 3Candidate 4: Case element: VerbCandidateCandidateFigure 2: Selection of possible parses for rerankingMany methods for reranking the parsing of En-glish ... trainingdata.3 Japanese dependency analysis takingaccount of co-occurrence informationand a combination of multiple casesOne constraint in Japanese is that multiple nouns of the same case do...
  • 8
  • 481
  • 0
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

... role of a mobile loop in substrate binding andenzyme activity of human salivary amylase. J Mol Biol325, 106 1–1 076.15 Ragunath C, Manuel SGA, Venkataraman V, SaitHBR, Kasinathan C & Ramasubbu ... Binding of B. subtilis xylanase mutants with a modified secondary binding site to water-unextractable arabinoxylan (WU-AX) (A) andoat spelt xylan (OSX) (B) and of A. niger xylanase mutants to water-unextractable ... phenylalanine and aspar-tate. The analysis, starting from protein hydrolysis, wasperformed in quintuplicate.Activity assays For all activity measurements of XBS and its mutants, a McIlvaine...
  • 14
  • 600
  • 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... diffracts to a Table 1. Statistics on data collection and refinement. A wavelength of 0.8726 A ˚was used. Rotations of 1° were performed. The Ramachan-dran plot was calculated usingRAMPAGE.X-ray ... assume a veryhigh binding constant of the protein for an extrane-ous ligand.We cannot state that the natural ligand of theH. pylori protein is erucamide, but the shape and size of the cavity ... 147,225 5–2 264.30 Leslie AGW (2006) The integration of macromoleculardiffraction data. Acta Crystallogr D Biol Crystallogr 62,4 8–5 7.31 Evans P (2006) Scaling and assessment of data quality.Acta...
  • 10
  • 768
  • 0
Tài liệu Báo cáo khoa học : Chủ tịch Hồ Chí Minh và bản di chúc hôm nay và mai sau ppt

Tài liệu Báo cáo khoa học : Chủ tịch Hồ Chí Minh và bản di chúc hôm nay và mai sau ppt

... dd lan nhau. Dd chfnh la ed ly, ed tinh, chan thanh, thang than, la van hoa Dang, la ban chat tam hdn va dao dQc dan tdc Viet ma Ho Chf Minh mong mdi va gQi lai eho toan Dang, toan ... that trung thanh cua nhan dan", mdi can bd, dang vien, doan vien va thanh nien phai het Idng tan trung vdi nQde, tan hieu vdi dan, phai tham nhuIn va nang cao "dao dQc each ... va giup dd" cudc khang chien eua nhan dan ta. Tuy nhien, la NgQdi sang lap va ren luyen Dang ta, bang dQ cam eua rieng minh, Hd Chf Minh tha'u hieu rang, mgi thang Igi eua Cach...
  • 4
  • 618
  • 1
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACPEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D ... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 ... AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGCATH1_pLC1 TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTTAATCATTGAGAACAATTTCCTTGATTGS....
  • 15
  • 475
  • 0
Tài liệu Báo cáo khoa học: Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins ppt

Tài liệu Báo cáo khoa học: Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins ppt

... 2), 3 4–4 3(strand B), 4 6–5 3 (strand C), 5 6–6 0 (strand D), 6 6–7 1(strand E), 7 6–8 5 (strand F), 8 8–9 2 (strand G), 9 6–1 03(strand H), 10 5–1 13 (strand I), and 11 6–1 24 (strand J).The analysis of chemical ... Tyr9 and Gln11 (strand A) , Arg32 (helixII), Val90, Lys92, and Glu94 (strand G), Phe96 andSer97 (strand H), Phe113 (strand I), and Arg120 andVal125 (strand J) (Fig. 7). We can conclude that, atvariance ... unchanged(Fig. 2A) . The quantitative volume analysis of thesepredominant forms indicated that binding site occu-pancies reached a plateau value, for both sites, at a protein ⁄ ligand ratio of...
  • 13
  • 529
  • 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... 18 9–1 95.21 Stephanou A, Isenberg DA, Nakajima K & LatchmanDS (1999) Signal transducer and activator of transcrip-tion-1 and heat shock factor-1 interact and activate thetranscription of ... TGGACGCGCGTAACCCGCACAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()298) Sense GCGCTGAAGCGCAGGCGGTCAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()194) ... 5¢-TCT ATC TCT CGA TGGATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTAGGT CAC T-3¢).Knockdown of Hsp10 5a and Hsp105bThe double-stranded RNA targeting Hsp105 (Dharmacon;5¢-GCA AAU CAC UCA UGC AAA...
  • 11
  • 584
  • 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... blot analysis polyclonal antibodies raised againstWhiB1 did not cross-react with WhiB4 and vice versa(data not shown). This may be because of variations inthe antigenic epitopes of WhiB1 and ... ferricyanide at a molar ratio of 1 : 50 : 20 (protein : EDTA : ferricyanide) at25 °C for 30 min. The chelated iron was removed bydialysis against buffer D and was used as apo protein for spectral ... wasgiven and blood was collected after 5 days. The serum wasisolated and the titer was determined by ELISA. Use of animals for the generation of polyclonal antibodies wascarried out with prior approval...
  • 18
  • 548
  • 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

... qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78,AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C (C) are presented ... response genes AaE7 5A, AaHR3, AaHR4, AaE78 (B), AaHR39, AaHR78(C), the competence factor AabFTZ-F1 isoforms A and B (C), the hepatocyte nuclear factor isoforms AaHNF- 4A, AaHNF-4B , AaHNF-4C (D),the ... PBM). These transcripts (AaUSP -A, AabFTZ-F 1A , AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) werealso analyzed in our in vitro assay. Any kind of fluctu-ation in expression levels...
  • 22
  • 578
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ