Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... 2011.c2011 Association for Computational LinguisticsMemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages Cheng-Te Li1 Chien-Yuan Wang2 Chien-Lin ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format. Conceptually, ... generating music melody au-tomatically based on detected sentiments, and (3) produce an animation of real-time piano playing for audiovisual display. Our MemeTube system can be accessed via:...
- 6
- 449
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... excess of information. FAQ-pages tend to alsoanswer questions which are not asked, and also con-tain practical examples. Human-powered answersoften contain unrelated information and discourse-like ... Takaaki Hori, and Sadaoki Furui. 2003.Evaluation Methods for Automatic Speech Summa-rization. In In Proc. EUROSPEECH, volume 4, pages2825–2828, Geneva, Switzerland.Valentin Jijkoun and Maarten ... Scholar-ship of Japanese Government and the 21st CenturyCOE Program ”Framework for Systematization and Application of Large-scale Knowledge Resources(COE-LKR)”ReferencesYllias Chali and Maheedhar...
- 9
- 610
- 1
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
... syntac- tic, semantic, and lexical rules are applied by a bottom-up all-paths constituent parser to populate a chart with edges containing syntactic, seman- tic, and logical form information. ... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... this paper describes the lexicon, grammar, and semantics of English, Gemini has also been used in a Japanese spo- ken language understanding system (Kameyama, 1992). 2.1. Grammar Formalism...
- 8
- 376
- 0
Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx
... to domain knowledge already encoded in the knowledge base of a limited domain natural language application such as a database query system. Given a hand-coded hierarchical organization of ... critiquing system& apos;, IBM Systems Journal, vol.21, 305- 326 Kaplan, R. and Bresnan, J.(1982) 'Lexical-Functional Grammar: A Formal System for Grammatical Representation' in J.Bresnan ... The Mental Representation of Grammatical Relations, The MIT Press, Cambridge, Mass, pp.173-281 Kay, M.(198 4a) 'Functional Unification Grammar: A Formalism for Machine Translation',...
- 8
- 393
- 0
Tài liệu Báo cáo khoa học: "Demonstration of the UAM CorpusTool for text and image annotation" docx
... id='1' start='158' end='176' features='participant;human' state='active'/> <segment id='2' start='207' end='214' ... developed to facilitate the human annotation of text. These have been necessary where software for automatic annotation has not been available, e.g., for linguistic patterns which are not easily identi-fied ... each layer panel). It also allows the user to add or delete source files to the project, and to open a specific file for annotation at a specific layer (each file has a button for each layer)....
- 4
- 498
- 0
Tài liệu Báo cáo khoa học: "Reading Level Assessment Using Support Vector Machines and Statistical Language Models" pdf
... parse features are generated using the Char-niak parser (Charniak, 2000) trained on the standardWall Street Journal Treebank corpus. We chose touse this standard data set as we do not have anydomain-specific ... alsouse a standard statistical parser (Charniak, 2000) toprovide syntactic analysis.In practice, a teacher is likely to be looking for texts at a particular level rather than classifying a group ... syntactic and semantic analy-sis. Statistical language models (LMs) are used suc-cessfully in this way in other areas of NLP such asspeech recognition and machine translation. We alsouse a...
- 8
- 446
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocytegrowth factor. ... Technology, Nagatsuta,Midori-ku, Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane ... ¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles). The GAPDH-specific primer set,5¢-AGGTGAAGGTCGGAGTCAAC-3¢...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... on A- domain specificity prediction and the available tran-scriptome data, can be applied for the initial detection and isolation of NRPs [20]. Furthermore, thisapproach substitutes the CAS assay-guided...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... procedureThe assay was run as a three-step assay: initial incubation ofthe sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition of donorbeads with ... compilation ª 2009 FEBSTransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2 and Mikko...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronariaRaka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa BiswasCrystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... S, Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55, ... Chakraborty S, Biswas S, Chakrabarti C &Dattagupta JK (2005) Crystallization and preliminaryX-ray diffraction studies of the cysteine protease erva-tamin A from Ervatamia coronaria. Acta...
- 14
- 634
- 0
Từ khóa: a sentimentbased audiovisual system for analyzingtài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ