Tài liệu Báo cáo khoa học: "Growing Related Words from Seed via User Behaviors: A Re-ranking Based Approach" pdf

... the ACL 2010 Student Research Workshop, pages 49–54,Uppsala, Sweden, 13 July 2010.c2010 Association for Computational LinguisticsGrowing Related Words from Seed via User Behaviors: A Re-ranking ... used as a relatively accurate standard for evaluation. We just want to investi-gate whether user behaviors and re-ranking framework is helpful in the related word retrieval task under various ... 51As a result, candidate words with higher se-mantic similarities can be returned earlier with enriched semantic features. Re-ranking can be regarded as a complementary step after candidate...

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

... theoriginally high basal activation state in a dose-depen-dent manner, and thus acts as an inverse antagonist ofERRc.ERRs are a subfamily of orphan NRs and are clo-sely related to two ERs: ERa and ... luciferase activity was measured by usingLuciferase assay reagent (Promega, Madison, WI, USA)according to the manufacturer’s instructions. SEAP activ-ity was assayed by using Great EscAPeä SEAP assayreagent ... program allfit [27]. Each assay wasperformed in duplicate and repeated at least three times.Cell culture and transient transfection assaysHeLa cells were maintained in Eagle’s modiﬁed Eaglemedium...

Tài liệu Báo cáo khoa học: Tachykinin-related peptide precursors in two cockroach species Molecular cloning and peptide expression in brain neurons and intestine docx

... for 3¢ and 5¢ nested rapidampliﬁcation of cDNA ends (RACE): lemRACE-F1:5¢-TCGCTGTTGCAGTACCTGGACTCC-3¢; lemRACE-B1: 5¢-GTCTACCAAGTCTCGAAGAAAGTCCTGCTG-3¢; peaRACE-F1: 5¢-GATGGAGGGCGCGGAGGAT-3¢;peaRACE-B1: ... 5¢-GATGGAGGGCGCGGAGGAT-3¢;peaRACE-B1: 5¢-CTTGCCCCTCATGCCATGGAAC-3¢.For both RACE reactions we used Advantage Taq 2Mixture (Clontech) and a P. americana RACE library con-structed previously [39]. A L. maderae RACE ... 275,23273–23280.9 Takeuchi H, Yasuda A, Yasuda-Kamatani Y, Kubo T& Nakajima T (2003) Identiﬁcation of a tachykinin- related neuropeptide from the honeybee brain usingdirect MALDI-TOF MS and its gene...

Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

... 213–222.66 Hamaguchi M, Hamada D, Suzuki KN, Sakata I &Yanagihara I (2008) Molecular basis of actin reorgani-zation promoted by binding of enterohaemorrhagicEscherichia coli EspB to alpha-catenin. ... Y, Sagara H, Kabe Y, Azuma M, Kume K,Ogawa M, Nagai T, Gillespie PG, Sasakawa C &Handa H (2007) The enteropathogenic E. coli effectorEspB facilitates microvillus effacing and antiphago-cytosis ... Structural analysis of a prototypicalATPase from the type III secretion system. Nat StructMol Biol 14, 131–137.38 Imada K, Minamino T, Tahara A & Namba K (2007)Structural similarity between...

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) andRGG1 ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC)Htelo ... primers: KGG3-2 forwardd(AAA GGT GGC AAA GGT GGA GAC AGA GGTGGC TT) and KGG3-2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers:...

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... by PCR from H. pyloriCCUG17874 genomic DNA using the following primers:forward, 5¢-CACCAAACCTTATACGATTGATAAGGCAAAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCTTCTAG-3¢. The construct was cloned ... diffracts to a Table 1. Statistics on data collection and reﬁnement. A wavelength of 0.8726 A ˚was used. Rotations of 1° were performed. The Ramachan-dran plot was calculated usingRAMPAGE.X-ray ... inter-actions reported below are repeated twice; that is, if Ala25 ofchain A is close to Asn77 of chain B, then Asn77 of chain A isclose to Ala25 of chain B.Chain A Chain B Hydrogen bondsAla25...

Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

... dinitrogen by Bacteriaand Archaea. Adv Microb Physiol 52, 107–227.24 Uthandi S, Saad B, Humbard MA & Maupin-FurlowJA (2010) LccA, an archaeal laccase secreted as a highly stable glycoprotein ... of plant ascorbate oxidase [33], human ceru-loplasmin [34], CotA laccase from B. subtilis [35], andMcoA from A. aeolicus [4], and they apparently cor-relate with a structural organization ... bothlaccases and metallo-oxidases, are well characterized ineukaryotes and bacteria, only one archaeal laccase hasbeen described so far [24]. Although the recombinantpuriﬁed McoP is similar...

Tài liệu Báo cáo khoa học: Enzyme kinetics informatics: from instrument to browser pdf

... performed.NOVOstar data parserJava data modelSpreadsheet(data and metadata)KineticsWizardInstrument independentSABIO-RKMeMo-RKExperimental data+ meta dataParameters+ meta dataWeb/web serviceWeb/web ... search capabilityfor kinetic data and corresponding metadata stored inSABIO-RK. The task of automatically ﬁnding para-meters and associated data is aided by specifying andstoring metadata ... KINETICSWIZARD provides a graphical user interface that allows the experimenter toassociate metadata to the experimentaldata. Kinetic constants are then calculatedand the data submitted to appropriate...

Tài liệu Báo cáo khoa học :Phương ngữ Thánh Hóa với việc phát triển văn hóa du lịch pdf

... "kha can trdc", nghia la ga gay canh dau, hoac "kha can, cho cam" nghia la ga gay, cho can, cay xoan dau gpi la "can du" td xda den nay van dddc ngddi dan d cac ... thanh ngd, tuc ngd, ca dao in dam phddng ngd xd Thanh, da dda each phat am, each dung td cua dia phddng nay hoa nhap vao ngdn ngd chung cua toan dan, gop phan lam giau cd them kho tang ... long lam cho cupc sdng ngay cang td't dep. Gia tri van hda nghe thuat va sac thai van hoa rieng. PhdOng ngd Thanh Hoa gop phan lam nen sac thai van hoa tinh Thanh khdng lan vdi...

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... leaflets. We thus conclude from these data that Ab interacts with the membrane in a Table 4. Average values of deuterium order parameters. Data are the mean (± SD).SimulationTop leaflet plateau ... domain revealed by self-assembly simulations. Proc Natl Acad Sci USA 104,2631–2636.20 Khalid S & Sansom MSP (2006) Molecular dynamicssimulations of a bacterial autotransporter: NalP from Neisseria ... thedeuterium order parameters of each leaflet separately,including the whole acyl chain and the ‘plateau region’described above. Taking the approach applied byBachar and Becker [18], we analyzed the...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf growing related words from seed tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM