Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx
Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx
... mechanism of lactoperoxidase and
myeloperoxidase
A reflection on some controversial features
Elena Ghibaudi and Enzo Laurenti
Dipartimento di Chimica I.F.M., Universita
`
di Torino, Italy
Although ... formulated a hypo-
thesis that describes an integrated vision of the catalytic
mechanism of both enzymes. The main points are: (a) a
re-evaluation...
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... ratios: at a 1 : 1 Fe
2+
⁄ protein ratio,
the resonances of Arg20, Asp22 and Asp23 disap-
peared, and the resonance of Leu21 shifted. At a 2 : 1
ratio, the resonances of residues 19 and 44 also ... spectrum of
CyaY, but the most striking consequence of the addi-
tion was the total disappearance of specific resonances
without the concomitant appearance of o...
Tài liệu Báo cáo khoa học: Probing the molecular determinants of aniline dioxygenase substrate specificity by saturation mutagenesis docx
... the
V20 5A mutant (B) and WT AtdA3 (C). Also
shown are the mononuclear iron (brown
sphere) and the catalytic facial triad of
H204, H209 and D356. (D,E) Molecular sur-
faces of the substrate channel ... deletion assay, the
atdA1 gene was amplified using the A1 _EcoRI_F and
A1 _SalI_R primers. The atdA2 gene was amplified using the
A2 _FseI_F and A2 _AvrII_R p...
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... pair similarity computation since the other
parts of speech (adjectives and adverbs) do not have
a taxonomic representation structure. For example,
the jcn similarity measure (Jiang and Conrath, ... [SE07], and Semcor.
We tune the parameters in wmfvec and other base-
lines based on SE2, and then directly apply the tuned
models on other three data sets.
Data: The se...
Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx
... were
Table 3. Specificity of monoclonal anti-(human transcobalamin) sera and their effect on the functional properties of transcobalamin. nd, not
done.
mAb
Epitope
cluster
Precipitation of
Apo-TC ... the maximal
mAb ⁄ heparin effect on the functional activ-
ity of TC. Arrows show the hypothetical
movement of the domains after attachment
of Cbl, see the main text....
Tài liệu Báo cáo khoa học: "Understanding the Semantic Structure of Noun Phrase Queries" pptx
... domains, Movie, Job
and National Park, and had them manually anno-
tated. The annotation was given on both segmen-
tation of the queries and classification of the seg-
ments according to the label ... tagged
as Brand. In particular, Li et al. leveraged click-
through data and a database to automatically de-
rive training data for learning a CRF-based tagger.
Manshadi...
Tài liệu Báo cáo khoa học: "Identifying the Semantic Orientation of Foreign Words" pdf
... polar-
ity. They assign any given word the label of its syn-
onyms or the opposite label of its antonyms if any of
them are known.
Kanayama and Nasukawa (2006) used syntactic
features and context ... construct a network
of words using gloss definitions, thesaurus and co-
occurrence statistics. They regard each word as an
electron. Each electron has a spin and each spi...
Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx
... GCCCCATGGCGGTGGATGGCATATGGGAGG
GGGTACCC
PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC
TCAAGC
PrP113–231 CCAACCTCAAGCATATGGCAGGG
PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC
PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC
PrPD112–136 CCAACCTCAAGCATGTGATGATCCATTTTGGC
PrPD135–150 ... 112–136
constitute part of the functional domain of the protein
provides a plausible explanation for the high evolutiona...
Tài liệu Báo cáo khoa học: "Selecting the “Right” Number of Senses Based on Clustering Criterion Functions" pdf
... 1 N , and then determines the mean and
standard deviation of the criterion function. Then,
a score is computed for each value of k by sub-
tracting the mean from the criterion function, and
dividing ... and
the 6 sense noun line. We also created 19 name
conflations where sets of 2, 3, 4, and 6 names of
persons, places, or organizations that are included
in the E...
Tài liệu Báo cáo khoa học: "Evaluating the Inferential Utility of Lexical-Semantic Resources" ppt
... 2007; Kazama and Tori-
sawa, 2007).
As of today, only a partial comparative picture
is available regarding the actual utility and limi-
tations of available resources for lexical-semantic
inference. ... inference, are commonly utilized by ap-
plied inference systems (Giampiccolo et al., 2007)
and applications such as Information Retrieval and
Question Answering (Shah and Cro...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Chuong 2 nhận dạng rui ro
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật