Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

... ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bio-science).Analysis of the N-terminal amino-acid sequences The N-terminal amino-acid sequences of the enzymes wereanalyzed using ... novel heterotetrameric amino acid dehydrogenase complex. Extremophiles 8, 99–108.4 Sakuraba H, Takamatsu Y, Satomura T, Kawakami R& Ohshima T (2001) Puriﬁcation, characterization, andapplication of a ... Dye-linked d-proline dehydrogenase from hyperthermophilic archaeon Pyrobaculum islandicum is a novel FAD-dependent amino acid dehydrogenase. J BiolChem 277, 12861–12867.3 Kawakami R, Sakuraba...

Tài liệu Báo cáo khoa học: A second independent resistance mechanism to Bacillus sphaericus binary toxin targets its a-glucosidase receptor in Culex quinquefasciatus docx

... (primer 3, GAAAAGCTTCAGCTGGAAGTTGAACGGCAT; primer 4, AACAAGCTTCACGAAATCTCCCAGGTCCAC; primer 7, AACAAGCTTGAAATCTCCCAGGTCCACGGT) were used. To facilitatecloning of the amplified fragments, primers ... of lymphatic filariasiswhich remains an endemic disease in some urbanareas. The status of Culex sp. as a disease vectorhas greatly increased in recent years vis a vis the spread of the West ... proteins in larvae BBMF thatbind specifically to Bin toxinAs an initial approach to identify the molecular basisfor the resistance of CqRL1 ⁄ 2362 larvae to the Bintoxin, we performed an assay...

Tài liệu Báo cáo khoa học: a-Defensins increase lung ﬁbroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

... b-catenin, suggesting that a- defensins activate the b-catenin signaling pathway. We then studied the roleof the b-catenin signaling pathway in a- defensin-induced increases in the proliferation and ... indicate that a- defensin-induced increases in lung ﬁbroblast proliferation and collagen synthesisinvolve the b-catenin signaling pathway.Inhibition of b-catenin signaling pathway usingquercetin ... The role of a- defensins in these diseases is notclear. Interestingly, it has been found that a- defensinlevels in bronchial alveolar lavage and⁄ or plasma areincreased in ﬁbrotic lung diseases,...

Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc

... a society. As shown in (Sable and Akcay, 2010) green represents danger in Malaysia, envy in Belgium, love and happiness in Japan; red is associated with luck in China andDenmark, but with bad ... terms and collo-cations that represent various hues, darkness, sat-uration and other natural language collocations.We also perform a comprehensive analysis of the data by investigating several ... ofconcepts and is there any correlation with a se-mantic orientation of a concept?Finally, we share our experience collecting the data using crowdsourcing, describe advantagesand disadvantages as...

Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx

... stress ascompared with the known Arabidopsis DExD ⁄ H mem-bers. The AtHELPS promoter::GUS and quantitativereal-time PCR analysis indicated that AtHELPS is mainly expressed in the vascular tissues, ... for further analysis (Fig. 1C).Spatiotemporal expression pattern of AtHELPS in ArabidopsisTo reveal the expression pattern of AtHELPS in Arabidopsis, total RNA was extracted from shoots androots ... elucidated.Besides, zeatin and cold treatments also increased the accumulation of AtHELPS mRNA in seedlings(Fig. S1), suggesting that additional roles of AtHELPSmight exist in Arabidopsis.Experimental proceduresPlant...

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

... A, Milella M et al. (2009) An integratedhumoral and cellular response is elicited in pancreaticcancer by alpha-enolase, a novel pancreatic ductaladenocarcinoma-associated antigen. Int J Cancer ... cells and B cells against ENOA, together withanti-ENOA autoantibodies in their sera. Clinical corre-lations propose ENOA as a novel target for cancerimmunotherapy. In pancreatic cancer, for example, ... promoting cellularmetabolism in anaerobic conditions and driving tumorinvasion through plasminogen activation and extracel-lular matrix degradation. It also displays a characteris-tic pattern...

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... (2010) Mathematical model-ling of the central carbohydrate metabolism in Arabid-opsis thaliana reveals a substantial regulatory in uenceof vacuolar invertase on whole plant carbon metabo-lism. ... simulation A mathematical model was developed, representing centralcarbohydrate metabolism in leaves of A. thaliana. The model was based on the following system of ordinary dif-ferential equations ... dynamics during acclimation to lowtemperature in Arabidopsis thalianaThomas Na¨gele, Benjamin A. Kandel*, Sabine Frana*, Meike Meißner and Arnd G. HeyerBiologisches Institut, Abteilung Pﬂanzenbiotechnologie,...

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

... I, Akinaga A, Kitano H,Yokoyama K, Satomura M, Kurosawa T, WatanabeM, Kawabata T, Chang W et al. (2009) Automatedimmunoassay system for AFP-L3% using on-chipelectrokinetic reaction and separation ... antibodies, and their glycan alterationwas examined by a lectin microarray. Finally, they were analyzed by multi-stage tandem MS.AbbreviationsAAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, ... glycosylation,glycan structural analysis systems, the bioinformaticscapability and the databases that we have developedover the years, and animal models of aberrant glyco-sylation and clinical samples,...

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... B, then Asn77 of chain A is close to Ala25 of chain B.Chain A Chain B Hydrogen bondsAla25 Asn77, Arg80 AlaO–ArgNH1AlaO–ArgND2Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1AsnOD1–HisNE2Ser28 Arg76Trp30 ... inhibit intestinal diar-rhea, and to regulate ﬂuid volumes in other organs[23]. At the same time, erucamide is a contaminant ofplastic materials, and is used, in particular, as a slipagent in ... pyloriCCUG17874 genomic DNA using the following primers:forward, 5¢-CACCAAACCTTATACGATTGATAAGGCAAAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCTTCTAG-3¢. The construct was cloned directly into the pET151 expression...

Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt

... control was maintained in a standard incubator with 21% O2. The normoxia data are the same as shown in Fig. 1 and are included here for comparison. Expression of miR-2 7a and miR-27b at the indicated ... were treated as described in (A) . Total RNA wasprepared at the indicated times and subjected to quantitative real-time PCR analysis. The data shown are mean value ± standard errors of the mean from ... Hosogai N, Fukuhara A, Oshima K, Miyata Y, TanakaS, Segawa K, Furukawa S, Tochino Y, Komuro R,Matsuda M et al. (2007) Adipose tissue hypoxia in obesity and its impact on adipocytokine dysregulation.Diabetes...

Xem thêm

Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ