Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf
Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf
... have not been devel-oped. Our approach is based on redefining the taskof lemmatisation as a category tagging task. Formu-lating lemmatisation as a tagging task allows the useof advanced tagging ... Genevatanja.samardzic@unige.chAbstractWe present a novel approach to the task ofword lemmatisation. We formalise lemmati-sation as a category tagging task, by describ-ing how a word-to-lemma transformation rulecan ... including agglutinative (Hungar-ian, Estonian) and fusional (Slavic) languages.2 Lemmatisation as a Tagging TaskLemmatisation is the task of grouping together wordforms that belong to the same...
- 5
- 456
- 0
Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx
... of a word as its vari-able. Each agent wiis associated with the variableswi. The value assigned to this variable indicatesthe sense assigned by the algorithm.3.3 DomainsSenses of a word ... HyderabadIndiagvsreddy@students.iiit.ac.inAbhilash InumellaIIIT HyderabadIndiaabhilashi@students.iiit.ac.inAbstractThis work models Word Sense Disam-biguation (WSD) problem as a Dis-tributed ... approaches: These approachescrucially rely on lexical knowledge base.Graph-based WSD approaches (Agirre andSoroa, 2009; Sinha and Mihalcea, 2007) per-form disambiguation over a graph composedof...
- 6
- 369
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... similarity. A crystalstructure of Met8P has shown that this protein hasan aspartate residue (Asp141), which is importantfor both chelatase and dehydrogenase function [17];interestingly, this aspartate, ... total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis and ... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitrificans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... theP1 data set is a consequence of highly anisotropic diffrac-tion, which forced us to discard part of the collected datato maintain reasonable merging statistics. The anisotropywas a consequence ... human dipeptidyl peptidase I(cathepsin C): exclusion domain added to an endopepti-dase framework creates the machine for activation ofgranular serine proteases. EMBO J 20, 6570–6582.18 Molgaard...
- 8
- 632
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into ... 5¢-AAGCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATCCAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full-length Skn cDNA, whose termination codon was changedto a BamHI site, was inserted between the SalI and ... seque-nce and were compatible with human species. As an inter-nal control, glyceraldehyde-3-phosphate dehydrogenase wasamplified using the primers 5¢-TCCACCACCCTGTTGCTGTA-3¢ and 5¢-ACCACAGTCCATGCCATCAC-3¢...
- 14
- 499
- 0
Tài liệu Báo cáo khoa học: "Humor as Circuits in Semantic Networks" doc
... humor/sarcasm recognition merits direct ap-plication to the areas such as information retrieval(Friedland and Allan, 2008), sentiment classifica-tion (Mihalcea and Strapparava, 2006), and human-computer ... lends itself as anideal ontological resource for script generation. As a network that connects everyday concepts and eventswith a set of causal and spatial relationships, the re-lational structure ... puns.E. Cambria, A. Hussain, C. Havasi, and C. Eckl. 201 0a. Senticspace: visualizing opinions and sentiments in a multi-dimensional vector space. Knowledge-Basedand Intelligent Information and Engineering...
- 6
- 546
- 0
Tài liệu Báo cáo khoa học: "Wikipedia as Sense Inventory to Improve Diversity in Web Search Results" doc
... using a Vector SpaceModel (VSM) and compared with a standardcosine measure. This is a basic approachwhich, if successful, can be used efficientlyto classify search results.• An approach based ... results as a set of (labelled)clusters rather than as a ranked list (Carpinetoet al., 2009).• Complementing search results with searchsuggestions (e.g. ”oasis band”, ”oasis fash-ion store”) that ... systems, becausethe algorithms provide an answer for every pagecontaining text (actual coverage is 94% becausesome pages only contain text as part of an imagefile such as photographs and logotypes).Table...
- 10
- 526
- 1
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... (+/–)-12-(9-anth-royloxy)stearic acid (ASA) was obtained from Sigma(France). ASA was dissolved in 10% v/v EtOH as 1 mMstock solution. Successive 0.1-lL ASA probe aliquots wereadded to 1 mL of ASP3c...
- 11
- 642
- 0
Tài liệu Báo cáo khoa học: "Interpretation as Abduction" potx
... what Thasard (1978) has called consilience and simplicity. Roughly, simplicity is that p (A) should be as small as possible, and consilience is that q (A) should be as big as possible. We want ... Interpretation as Abduction Jerry R. Hobbs, Mark Stickel, Paul Martin, and Douglas Edwards Artificial Intelligence Center SRI International Abstract An approach to abductive inference ... I, least specific abduction is favored why assume PI and P2 when it is cheaper to assume Q. But in pis ^ P~s ~ Q if PI has already been derived, it is cheaper to assume P2 than ~. P1 has provided...
- 9
- 399
- 0
Tài liệu Báo cáo khoa học: "Translation as Weighted Deduction" pdf
... Translation Model Design A motivation for many syntax-based translationmodels is to use target-side syntax as a languagemodel (Charniak et al., 2003). Och et al. (2004)showed that simply parsing ... abstract,our motivation is practical. Isolating the errorsin translation systems is a difficult task which canbe made easier by describing and analyzing mod-els in a modular way (Auli et al., ... non-local parame-terizations such as an n-gram model (Equation 2).Suppose we have a derivation D = (d1, , dM),where each dmis a rule application. We can viewthe language model as a function...
- 9
- 322
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM