0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: The double-stranded RNA-binding motif, a versatile macromolecular docking platform doc

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

... clear whythese RRM domains that are very similar to the classical ones favor interaction with proteins ratherthan RNA.Conclusion and perspectives The RNA recognition motif is an abundant and ... crucial importance to dramatically enhance the RNA-binding affinity by increasing the protein–RNAinteraction network. In most RRM–RNA complexes, the base stacking on the aromatic residue at RNP ... with U 2A (Fig. 5B). The adaptability of the RRM domain is further illustrated here, as the keyresidue Arg52 still interacts with the RNA stemalthough the closing base pair is a UU base pair inU2snRNA...
  • 14
  • 428
  • 0
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

... benzo [a] pyrene-2¢-deoxyguanosineadducts affects DNA methylation by SssI and HhaI DNAmethyltransferasesOksana M. Subach1, Diana V. Maltseva1, Anant Shastry2, Alexander Kolbanovskiy2,Saulius Klimasˇauskas3, ... Wyszynski MW, Gabbara S, Kubareva EA, RomanovaEA, Oretskaya TS, Gromova ES, Shabarova ZA &Bhagwat AS (1993) The cysteine conserved amongDNA cytosine methylases is required for methyl trans-fer, ... The B [a] P-DNA adducts also affect the function of humantopoisomerase I by alteration of DNA cleavage patterns[20]. The greatest disturbance of DNA cleavage iscaused by the (+)-trans-B [a] P-N2-dG...
  • 14
  • 558
  • 0
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

... the genome: a marriage made by evolution. Chromosoma114, 212–219.32 Glass CA, Glass JR, Taniura H, Hasel KW, Blevitt JM& Gerace L (1993) The alpha-helical rod domain ofhuman lamins A and C contains ... AM, Columbaro M, Scarano G, MattioliE, Sabatelli P, et al. (2005) Alterations of nuclear envel-ope and chromatin organization in mandibuloacral dys-plasia, a rare form of laminopathy. Physiol ... normally located abutting the nuclear lamina inother cell types containing A- type lamins, are locatedaway from the nuclear edge (Foster H, Griffin D andBridger J, unpublished data). Taken together...
  • 8
  • 510
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

... where the states of affairs themselveshave mappees in the target domain, then the change event has a mappee that is a change eventbetween the latter states of affairs.Time-order VNMA: The time-order ... map-pee events.Mental/Emotional States VNMA: If someagents in the source domain have mappees thatare also agents, then their mental and emotionalstates map identically, provided that the ... query:to-degree-exactly(Degree):can-consciously-mentally-operate-on(anne, the- idea-that(having-affair(kyle))).where D is a variable, or in other words, to whatparticular degree is the affair idea consciouslyentertainable...
  • 6
  • 455
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... domain and the functionalrelationship of tandemly repeated domains in BPPs. We conjecture thatdual-domain BPPs have succeeded evolutionarily because they can increase the amount of available ... wasdetermined using the Bradford assay with BSA as the standard [28].Phytase activity assayPhytase activity was determined by measuring the amountof phosphate released from InsP6using a modified ferroussulfate ... determination of the phytase geneStrain HJB17 was cultured in Luria–Bertani medium at37 °C overnight and genomic DNA was extracted using the TIANamp Bacteria DNA kit (Tiangen, Beijing, China).The...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... by the importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma-tional rearrangement that exposes the NLS in an extended conformation.DatabaseStructural data are available ... (excluding water moleculesand peptide atoms) and rjis the standard deviation of Bfactors. The normalized B factors have a zero mean and unitvariance. All atoms that satisfy Bz‡ 4 are treated as ... as the major and minor binding sites [1]. These sites arelocated in the concave face of the protein near regionsof invariant Trp and Asn arrays. The major bindingsite spans ARM repeats 2, 3 and...
  • 14
  • 741
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... SJ, Ward ER, RyalsJA & Dangl JL (1994) Arabidopsis mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,Miyao A, Kawasaki T, ... artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and the bottom panel shows the ... PTI1-4(At2g47060) was cloned in the pBD-GAL4 cam (Stratagene,La Jolla, CA, USA) and were each used as bait to screen anArabidopsis pACT2 cDNA library [36]. The yeast strainPJ69- 4A [37] containing...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... control to pathways regu-lated by p53, E2F and the pRB family.AcknowledgementsG .A. M. was the recipient of a graduate fellowshipawarded by the Freistaat Sachsen. Research in ourgroup was supported ... CHR, yielded a further decrease in regulation. The CDE alone was nottested [41]. The CDE mutation that was assayed wouldalso alter a putative CDE site with the standard dis-tance of four nucleotides ... during the cell cycle.Biochem Biophys Res Commun 320, 951–960.48 Kidokoro T, Tanikawa C, Furukawa Y, Katagiri T,Nakamura Y & Matsuda K (2008) CDC20, a potentialcancer therapeutic target,...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... reagents and the recombinant humanTRAIL ⁄ APO 2 ligand were purchased from Invitrogen andFeldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitorsubstrate ... substrate. Backgroundreadings were subtracted from all samples and caspase 3activity expressed as a fold increase over nontransfectedand nontreated control cells.Statistical analysisStatistical ... cytochrome c and second mitochondria-derivedactivator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell [18,19].In...
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)SJS138 TACGAGATCTTAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)SJS172 GGGATCATGCCCAAGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)SJS173 AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse ... GACCCCTTCATTGACCTCAACTA Forward (nt 163–185 GAPDH)SJS209 CTTGATTTTGGAGGGATCTC Reverse (nt 318–299 GAPDH)SJS275 TTAGCTACATTAAATAGGCAG Reverse (nt 1620–1601 PAI-2)SJS276 GtaatacgactcactataGGGATCATGCCCATTTAG...
  • 14
  • 635
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM