0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx

Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx

... didn cam giup khcd day cac chidu canh cam xdc phong phu d ngudi nghe. Mudn dat dugc didu dd, ngudi dgc phdi cd dugc cam gidc hda nhdp vdi cdu chu, rang ddng thyc sy vdi nhung didu dang dgc. ... ro chu thi de dgc didn cam, ngucd dgc khdng chi can co chdi gigng dep, sang, am, ma quan trgng la cd nghe thudt sit dung cac phuang tien ngd dm: biet each ngdt nghi nhanh lau, biet cbd ... phong su" (d diy chi di cap din viec dpe tic phim bio chi, khdng ban din viec doc cic tic pham van hpc nghi thuat tren song) dugc thd bien bdng phuang thdc dgc phy thude rdi Idn...
  • 6
  • 741
  • 1
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA ... sense,5¢-CCGAGATCTGGCTTTTACTTAAACCG-3¢; IL6Rantisense, 5¢-CAGGAATTCACTTGCTCTGTCACCC-3¢;GAPDH sense, 5¢-GCGAATTCCGTGTCCCCACTGCCAACGTGTC-3¢; GAPDH antisense, 5¢-GCTACTCGAGTTACTCCTTGGAGGCCATGTGG-3¢. The PCR productswere ... mech-anisms of gastric cancer remain to be elucidated. Gastriccancer is a complex genetic disease, in which the expres-sion of many speci c genes, known as oncogenes or tumor suppressors, is abnormally...
  • 9
  • 541
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... mass of the recombinant HpSDH, which is in good agreement with the theoretical molecularmass of 30 041 Da calculated according to the aminoacid sequence. This result thereby demonstrates the ... sequencing result, a pair of PCR primers (sense:5¢-GCGCATCCATATGAAATTAAAATCGTTTGG-3¢ andantisense: 5¢-CCGCTCGAGAAAAACGCTTCGCATGAC-3¢) were synthesized to clone aroE gene from H. pylori strainSS1. ... Shen1,21 Drug Discovery and Design Center, State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai, China2 School of Pharmacy, East China University...
  • 11
  • 529
  • 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

... the higher fluorescence and less accessibility tocollisional quenchers of the bound e-ADP, which is characteristic of G-actin [40]. Moreover, the affinity of Pi to G-actin is an order of magnitude ... F-actin. Cofilin induced allosteric changes in the nucleotidecleft of F-actin are also indicated by an increase in fluorescence emissionand a decrease in the accessibility of etheno-ADP to collisional ... Because of the presence of this cap at the barbed end the criticalconcentration for polymerization of F-actin is low.F-ADP-actin can also be polymerized from ADP–G-actin in the absence of...
  • 9
  • 487
  • 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... AGC CCC CTC GAG TCG TTC AG-3¢ Reverse sad, cloning55¢-CGT CAC GGT ATT CGA AGC C- 3¢ Forward mao, RT-PCR65¢-CAC TGG CTA ATT CCA GTG C- 3¢ Reverse mao, RT-PCR75¢-CAC TAG CGA AGA TGC CGT C- 3¢ Forward ... RT-PCR85¢-CCA ACG CAG AAA CTC GGC-3¢ Reverse sad, RT-PCR95¢-CGG CAT TAT CGG TGA CAG C- 3¢ Forward mabO, RT-PCR10 5¢-CGC GCA ACA CTG AGG GAC-3¢ Reverse mabO, RT-PCR c- N-methylaminobutyrate catabolism ... acidsemialdehyde is then converted to succinate by the SsaDH encoded by the sad gene of pAO1 (see Fig. 2).Succinate may enter the citric acid cycle, thus comple-ting the catabolic pathway of CH3-4-aminobutyrategenerated...
  • 9
  • 524
  • 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... suggest a role for the PDGF -C in the development of lung fibrosis.One of the characteristics of pancreatic cancer is the overproduction of extracellular matrix by interstitialcells. This results ... factors show a high sequence identity. The fourPDGFs are inactive in their monomeric forms. Theyshare the same receptors; the PDGF receptor-a and -b.These receptors dimerize when the dimeric ... the CUB domain of PDGF -C exhibits mitogenicactivity on human coronary artery cells independent of the presence of its growth factor domain, suggesting apossible biological activity of the CUB...
  • 19
  • 557
  • 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... monomer (the Ôcytochrome b, subunit 7, subunit 8 coreÕ). Cytochrome b is colored blue, subunit 7 is coloredpink, and subunit 8 is colored green. The arrow labeled (a) points to the N-terminus of cytochrome ... decreasewas found in the case of subunits 7, 8 and 9.Cytochromebc1 subunit analysis of cytochromebdeletion mutantsCrystal structures of the bc1complexes indicate thatcytochrome b is the ... strain the amounts of the other twocatalytic subunits, cytochrome c 1and the ISP, were reducedby about 70–80% (Fig. 4A ,C) . In the case of the strainTable 4. Cytochrome bc1 subunit analysis of...
  • 10
  • 517
  • 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... protocols. PCR pri-mers located in the second and third exons of the humanCRYGN gene were used for amplification: NgcdsA, TCTCTATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTCCCCGTACACCTTGATGGTGTTC. Bands ... testis at LifeTechnologies (now Invitrogen). Libraries were screened forhuman cN-crystallin expression by PCR, using these prim-ers: NgcdsA, TCTCTATGAAGGCAAGCACTTCACAGG;NgcdsB, CCGTCCCCGTACACCTTGATGGTGTTC. ... CCGTCCCCGTACACCTTGATGGTGTTC. The following oligonucleotides were used as bait to hybridizeclones from the positive library: Hngtrap1, ATGAACCGAGTGAACTCCATCCAC; Hngtrap2, ACTTCTTCCGCTGGAACAGCCACA. The...
  • 16
  • 561
  • 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... ISense:5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢Antisense:5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢Rat (gi:474939) prolylhydroxylase alpha ISense:5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢Antisense:5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢Mouse ... IISense:5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢Antisense:5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢Rat (gi: 6754969) prolylhydroxylase alpha IISense:5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢Antisense:5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢Mouse ... Col1a1Sense:5¢-ACCTCAAGATGTGCCACT-3¢Antisense:5¢-TCCATCGGTCATGCTCTG-3¢Rat (gi: 807263) procollagen Col1a1Sense:5¢-ACCTCAAGATGTGCCACT-3¢Antisense:5¢-GATGTACCAGTTCTTCTG-3¢Mouse and rat (gi: 6671508) b-actinSense:5¢-CGGGATCCCCGCCCTAGGCACCAGGGTG-3¢Antisense:5¢-GGAATTCGGCTGGGGTGTTGAAGGTCTCAAA-3...
  • 8
  • 434
  • 0
Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

... aday prior to transfection with 5 lg of total plasmid DNA:pCISGaq or pCISGa16in presence or absence of pCISM1R or pCISM2R ⁄ pCISC5aR (Ga ⁄ R ¼ 0.4 ⁄ 0.6), respectively. The total amount of DNA ... activation of Ga16and Gaqsubunits. Therefore the lack of change in the rate of degradation cannot be due to lack of receptor-activa-tion of the alpha subunits.Given that the activation of ... constitutive activity, indicating that the activatedmutant is as stable as the wild-type form (Fig. 4B).Accordingly, the levels of Ga16decay were the same in the presence or absence of carbachol (Fig....
  • 13
  • 465
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họctai lieu bao cao thuc tap khoa duocNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ