Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... the association of the variable heavy chain (VH)with protein A was used as a surrogate for direct stability measurements. The VHdomains in camelid heavy chainantibodies are most similar to ... Another major focus has been to obtain quanti-tative data on b-sheet stability determinants. We have suc-cessfully adapted a phage-display method for quantitating a nities of protein variants (shotgun ... MINIREVIEW Phage-display as a tool for quantifying protein stability determinants Joanne D. Kotz1, Christopher J. Bond2and Andrea G. Cochran11Department of Protein Engineering and2Medicinal...

Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf

... Genevatanja.samardzic@unige.chAbstractWe present a novel approach to the task ofword lemmatisation. We formalise lemmati-sation as a category tagging task, by describ-ing how a word-to-lemma transformation rulecan ... European languages having different morpho-logical complexity, including agglutinative (Hungar-ian, Estonian) and fusional (Slavic) languages.2 Lemmatisation as a Tagging TaskLemmatisation ... lemmatisation task as a tagging task is that it allows us to apply success-ful tagging techniques and use the context informa-tion in assigning transformation labels to the wordsin a text. For...

Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

... of a word as its vari-able. Each agent wiis associated with the variableswi. The value assigned to this variable indicatesthe sense assigned by the algorithm.3.3 DomainsSenses of a word ... approaches: These approachescrucially rely on lexical knowledge base.Graph-based WSD approaches (Agirre andSoroa, 2009; Sinha and Mihalcea, 2007) per-form disambiguation over a graph composedof ... HyderabadIndiagvsreddy@students.iiit.ac.inAbhilash InumellaIIIT HyderabadIndiaabhilashi@students.iiit.ac.inAbstractThis work models Word Sense Disam-biguation (WSD) problem as a Dis-tributed...

Tài liệu Báo cáo khoa học: "Empirically Estimating Order Constraints for Content Planning in Generation" pptx

... ofdata available for these experiments all these pa-rameters were hand-tunned.4.2 Qualitative evaluationThe system was executed using all the availableinformation, with the same parametric ... present a method for learn-ing the basic patterns contained within a plan andthe ordering among them. As training data, weuse semantically tagged transcripts of domain ex-perts performing the task ... Natural LanguageGeneration (INLG-2000), pages 194–200, MitzpeRamon, Israel.Andrea Califano. 1999. Splash: Structural pattern lo-calization analysis by sequential histograms. Bioin-formatics,...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... dehydrogenase-ferrochelatasefrom Saccharomyces cerevisiae), we found that thetwo proteins had 24% sequence similarity. A crystalstructure of Met8P has shown that this protein hasan aspartate residue ... 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene cluster for dissimilatory nitrite reductase (nir)from Pseudomonas aeruginosa: sequencing and identiﬁ-cation of a locus for heme ... residue (Asp141), which is important for both chelatase and dehydrogenase function [17];interestingly, this aspartate, Asp129, is also conserved98kDaM WtInsolubleTotal cell lysatePeriplasmMembraneCytoplasmkDaM...

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC)Htelo ... methylation characteristicsof protein arginine methyltransferase 1 and 3 towardthe Ewing sarcoma protein and a peptide. Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev...

Tài liệu Báo cáo khoa học: Steﬁn A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... theP1 data set is a consequence of highly anisotropic diffrac-tion, which forced us to discard part of the collected datato maintain reasonable merging statistics. The anisotropywas a consequence ... human dipeptidyl peptidase I(cathepsin C): exclusion domain added to an endopepti-dase framework creates the machine for activation ofgranular serine proteases. EMBO J 20, 6570–6582.18 Molgaard...

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into ... [43–49].AcknowledgementsThe authors thank Drs Masato Yasui, Sadakazu Aisoand Masaaki Matsuoka for support; Dr AndrewP. McMahon for providing the full-length mou-se Shh cDNA; Dr Neil Cashman for providing ... 5¢-AAGCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATCCAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full-length Skn cDNA, whose termination codon was changedto a BamHI site, was inserted between the SalI and...

Tài liệu Báo cáo khoa học: "Humor as Circuits in Semantic Networks" doc

... humor/sarcasm recognition merits direct ap-plication to the areas such as information retrieval(Friedland and Allan, 2008), sentiment classiﬁca-tion (Mihalcea and Strapparava, 2006), and human-computer ... lends itself as anideal ontological resource for script generation. As a network that connects everyday concepts and eventswith a set of causal and spatial relationships, the re-lational structure ... Computational Semantics, pages 385–389. Association for Computational Linguistics.O. Stock and C. Strapparava. 2002. Hahacronym:Humorous agents for humorous acronyms. Stock,Oliviero, Carlo Strapparava,...

Tài liệu Báo cáo khoa học: "Wikipedia as Sense Inventory to Improve Diversity in Web Search Results" doc

... results as a set of (labelled)clusters rather than as a ranked list (Carpinetoet al., 2009).• Complementing search results with searchsuggestions (e.g. ”oasis band”, ”oasis fash-ion store”) that ... systems, becausethe algorithms provide an answer for every pagecontaining text (actual coverage is 94% becausesome pages only contain text as part of an imageﬁle such as photographs and logotypes).Table ... efﬁcientlyto classify search results.• An approach based on a state-of-the-art su-pervised WSD system, extracting training ex-amples automatically from Wikipedia con-tent.We also compute two baselines:•...

Xem thêm