Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... covalent modifications of the enzyme, the
effect of the inhibitor on the molecular mass value of
HAD was measured; instead of an adduct increase, or
no change, the value had unexpectedly decreased from
22 ... mod-
ifications [42].
Fig. 9. ECD spectral data from the RNase A deamidation samples of Fig. 8. Deamidation at an individual residue of a specific product causes...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Tài liệu Báo cáo khoa học: Complete subunit sequences, structure and evolution of the 6 · 6-mer hemocyanin from the common house centipede, Scutigera coleoptrata pptx
... bp of the respective 5¢ untranslated
regions and the entire 3¢ untranslated regions. The standard
polyadenylation signals (AATAAA) and the poly (A) -tails
of different lengths are present in each ... crustacean and insect hemocyanins. All analyses support
a pancrustacean taxon of the insect and crustacean proteins
that excludes the myriapod hemocyanins. Within the clade...
Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx
... deproto-
nated at neutral pH to make a hydrogen bond with
the side chain of Ser278 and act as a weak general
base catalyst (without the help of Asp82), making an
inefficient surrogate of the c-carboxy ... active
sites of these enzymes contain a unique catalytic triad,
Ser-Glu-Asp, in place of the canonical Ser-His-Asp
triad of the classical serine peptidases. In th...
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... this
alignment that all PAS- annotated A. thaliana proteins also
contain a PAC motif, and conversely that all PAC-
annotated A. thaliana proteins contain a PAS domain.
Therefore, in the case of A. ... multiple PAS domains, created a list of
958 PAS sequences. The PFAM-alignment of the PAS
domains was used as an initial alignment. All amino acid
residues extend...
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... in
A. thaliana PS. Val111 and Gly113, on the other hand,
are both affected by both pantoate and ATP. These
residues have their positional equivalents in Val137 and
Arg139 in A. thaliana PS, as ... mm.
Purification of the C-terminal domain of PS
The cell lysate was passed through a DEAE anion exchange
column. The protein was eluted with a linear gradient of
NaCl (0–500 mm)...
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... that is capable of binding several
different families of transcriptional activators [30], and
evidence indicates that the KIX domain has the ability
to simultaneously interact with at least two ... indicated in blue. The location of the extended loop is indicated with an arrow. (B) The CBP–KIX domain : cMyb binary complex. The
CBP–KIX domain is shown in orange and the...
Tài liệu Báo cáo khoa học : Bản chất của khủng hoảng kinh tế thế giới pdf
... hoang ba't ddng san d Hoa Ky.
Bay gid ngUdi ta cho rang nguyen nhan cua
ta't ca cac KH
nay
la
sii
dau cd cua cac ngan
hang
va
cdng ty da qud'c gia de bu
vao
cai da
ma't ...
cac nfldc dang phat trien (A. Panagaraya,
2005):
1.
Cac nUdc da phat trien bao ve bien gidi
va
trd cap rat cao.
2.
Trd ca'p va bao ve ciia cac nUdc da phat
trien ra't cd b...
Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf
... Higuchi et al. [30]
to obtain cDNAs encoding M25L–elafin and M63L–trap-
pin. For this purpose, forward primers 5¢-CGACTCGA
GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC
TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ ... oxidized elafin and trappin. The data
for the native inhibors are from Zani et al. [15]. The k
diss
and K
i
values are experimental, whereas the k
ass
values are calculated. MPO,
myeloperox...
Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc
... measured at the
interface between a solid and a liquid phase, and cal-
culated as the ratio of two rate constants. However,
values of DDG and DDG¢ for mutant Fab fragments,
calculated from values ... wells of a microtiter plate and the bound
Fab4E11-H6 was revealed with a goat antibody, directed against
mouse Fab and conjugated with alkaline phosphatase. The total
concen...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật