0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site.The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTTTATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and thereverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAAAGTGCGGCTCGAT-3¢ ... oligomers5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21cells were transformed with the pETM11 construct and grown until a D of 0.8...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465.9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T,Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007)PRTFDC1, a ... filter paper assay and tritium-labeledsubstrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. kcatwas calculated usingMw(HPRT) = 27132 Da and ... HPRT and several bacterial and protozoan HPRTs have been undertaken [13–17]. Thestructure of human HPRT can be divided into twodomains: a core domain and a hood domain [14,18].The HPRTs have a...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... molecular masswas also estimated by SDS–PAGE. Characterization and comparative analyses of HYDJs and HYDBpThe optimal temperature for activity of HYDJswith d-p-HPH as substrate was determined ... molecular basis of enzyme thermosta-bility. J Bacteriol 185, 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal-ysis to amino acid-based chiral pharmaceuticals - exam-ples and perspectives. J Mol Catal B-Enzym 5, 1–11.14 Liljeblad A & Kanerva LT...
  • 14
  • 621
  • 0
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

... [29] agreeswith the large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter workrevealed that EF-hands II and VI of Calb do not bindcalcium and that ... Groves1, Attila Ambrus2,*, Agata Kaleta1, Katalin E. Ko¨ve´r3, Gyula Batta4 and Jacek Kuz´nicki1,51Department of Molecular and Cellular Neurobiology, Nencki Institute of Experimental ... standard method of assigning protein backbone HN, NH,CA, HA, CB, HB and CO chemical shifts was used, basedon protocols described in Cavanagh et al. [35] and Sattler[36]. The sample contained...
  • 9
  • 648
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... suggestthat Keq A and the associated kon and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity of NOS enzymes,particularly in the CaM-free state.Do ... done toobtain measures of Keq A and the associated k1 and k2values for dual-flavin enzymes, particularly when theyare poised in all catalytically relevant intermediateredox states (1-, 2-, ... koffparameter of equilibrium A [58] and may possibly increase the konparameter as well. Unfor-tunately, the shift in Keq A caused by CaM prevented anaccurate measure of the koffparameter in CaM-boundeNOS...
  • 16
  • 639
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... Thebinary complex has a characteristic p-p charge transfer(CT) absorbance and NAD(P)H binding and dissocia-tion can be measured by following the formation of thisCT absorbance at, for example, ... cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions may be a large reorganization energy.The ... Markham KA & Kohen A (2006) Analytical proce-dures for the preparation, isolation, analysis and pres-ervation of reduced nicotinamides. Curr Anal Chem 2,379–388.48 Viola RE, Cook PF &...
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... cysteines located in both of the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in theattachment of PsaC [12]. PsaC, PsaD and PsaE arelocated at the cytosolic site (Fig. 1A) [2,7,13–16]. ... ferredoxin-NADP+reductase in Anabaena PCC. Biochemistry 42,2036–2045.90 Casaus JL, Navarro JA, Herva´s M, Lostao A, De laRosa MA, Go´mez-Moreno C, Sancho J & Medina M(2002) Anabaena sp. ... & Hase T(2007) Cloning and characterization of ferredoxin and ferredoxin–NADP+reductase from human malariaparasite. J Biochem 141, 421–428.154 Leadbeater C, McIver L, Campopiano DJ,...
  • 17
  • 634
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... Co-crystallization and soaking trialswith various putative substrates such as AMP, GMP and CMP have not so far been successful.Apart from Mg2+ and water molecules, a strongtetrahedral density was...
  • 10
  • 553
  • 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... Essential genes of a minimal bacte-rium. Proc Natl Acad Sci USA 103, 425–430.12 Yamanaka K, Ogura T, Niki H & Hiraga S (1992)Identification and characterization of the smbA gene, a suppressor ... Structural and functional investigations of Ureaplasmaparvum UMP kinase – a potential antibacterial drug targetLouise Egeblad-Welin1, Martin Welin2,*, Liya Wang1 and Staffan Eriksson11 ... a7 was only present in archaea, and was referred to as thearchaea-specific loop (Fig. 1). Another difference thatwas detected was in the loop between a3 and a4 ,which was absent in archaea, and...
  • 12
  • 656
  • 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... toan open reading frame (ORF) of EhPGDH was amplifiedby PCR using a cDNA library [26] as a template, and oligonucleotide primers (5¢-caGGATCCaagatagttgtgataaccga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), ... from Gly and Ala from Cys and conversions between Asp and Asn and between Glu and Gln [49]. Serine metabolic pathwaysare often absent in parasitic protists; the majority of theseprotists, as mentioned ... protozoan parasite Entamoeba histolytica. Mol. Biochem.Parasitol. 97, 33–44.27. Nozaki, T., Asai, T., Sanchez, L.B., Kobayashi, S., Nakazawa, M.& Takeuchi, T. (1999) Characterization of the...
  • 12
  • 464
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ