Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... procedures Isolation of the tyrosinase gene from Trichoderma reesei The tyr2 gene was amplified from genomic T. reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC ... TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC A GT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A. The PCR reaction...
Ngày tải lên : 19/02/2014, 06:20
  • 14
  • 650
  • 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... was PCR amplified from chromosomal DNA of P. furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), ... to homogeneity. The enzyme has a tetrameric conformation with a molecular mass of  155 kDa. The catalytic activity of the enzyme increases up to 100 °C, and a half-life...
Ngày tải lên : 16/03/2014, 14:20
  • 8
  • 415
  • 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... showed a pattern of two bands of approximately 28 and 34 kDa, related to A and B-chains respectively (Fig. 1B). The slight differences in the migration pattern of...
Ngày tải lên : 18/02/2014, 16:20
  • 12
  • 763
  • 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ ... Remarks 15¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C...
Ngày tải lên : 19/02/2014, 07:20
  • 19
  • 706
  • 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... follows: HSF 1a forward, 5¢-GAAGCAGCTTGTCCAGTACACCAA-3¢; HSF 1a reverse, 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢; HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACAC CTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGC CAGTAGC-3¢; ... Plasmid Cloning kit (Invitrogen) and was used as the PCR template. For 5¢-RACE, the first PCR was performed with the M13 reverse primer (5¢-AGCGGATAACAATTTCACACAGG-3¢)asa sense prim...
Ngày tải lên : 19/02/2014, 12:20
  • 10
  • 538
  • 0
Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx

Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx

... lexicon from a theoretical, computational and also practical viewpoint. INTRODUCTION It has been traditionally assumed by computational linguists and particularly by designers of large natural ... whereas the actual words are the those potential words that are realized in this language. To give an example, both arrival and arrivation are potential English words, but o...
Ngày tải lên : 22/02/2014, 09:20
  • 8
  • 535
  • 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

... (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢). These primers contained BstEII and BamHI sites and were used to generate a fragment that was cloned in the same sequencing and expression ... epitopes in Aspf1 that are changed in wild-type a- sarcin, as the response against the sera of the patients is still lower for the latter than for the Aspf1D(7–22) mutant...
Ngày tải lên : 16/03/2014, 19:20
  • 9
  • 517
  • 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Nagasawa T, Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purification and characterization ... was used for the analyses. (A) Total RNA was extracted and 20 lg RNA was loaded in each lane and blotted as indicated in Experimental procedures. To prove equal loading of the ex...
Ngày tải lên : 16/03/2014, 18:20
  • 14
  • 565
  • 0
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

... and activates a latent endoribonuclease, RNase L [3]. Activated RNase L catalyzes the degradation of viral and cellular RNAs, including ribosomal RNA, sup- pressing protein synthesis and viral ... mixture of A2 ¢p5 A2 ¢p5 A and A3 ¢p5 A2 ¢- p5 A( m ⁄ z 924.6); 12, A2 ¢p5 A3 ¢p5 A( m ⁄ z 924.7); 13, putative A2 ¢p5 A2 ¢p5 A3 ¢p5 A( m ⁄ z 1253.9); 14, mixture of A3 ¢p5 A...
Ngày tải lên : 23/03/2014, 09:20
  • 13
  • 429
  • 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... complex than in T cells, with several peaks of nuclease hyper- sensitivity [85]. Mast cells express GATA-2 as well as NFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ... environment that also enables Sp1 and Runx1 binding [85,86,233]. Both NFAT and AP-1 have the potential to recruit the HATs CBP and p300 which may allow the formation o...
Ngày tải lên : 14/02/2014, 18:20
  • 29
  • 743
  • 0

Xem thêm

Từ khóa: