Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... asialoglycoprotein receptor; CHO, Chinese hamster ovary; ER, endoplasmic reticulum; HCV, hepatitis C virus; HCVpp, HCVpseudotyped particles; HCVcc, cell culture-derived HCV particles; HDL, high-density ... responseduring acute and chronic hepatitis C virus infection.Proc Natl Acad Sci USA 101, 10149–10154.52 Flint M, Logvinoff C, Rice CM & McKeating JA(2004) Characterization of infectious retroviral ... uses CD4 and either CXCR4 or CCR5 asreceptors to infect cells. Recently, an isolate was identi-ﬁed that can infect CD8 T-cells which are CD4-negat-ive [90]. HSV can use different entry receptorsbelonging...

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... from the C- terminal domain wereas follows: 2FIRREV, 5¢- CCNCKNABRAAMANATCCTGTCC-3¢; CTERMREV, 5¢-TCNGCNCCRTACCARTC-3¢.Fig. 3. Molecular dynamics simulations. Ribbon representation ofCa chain ... frequently adjacent (sixoccurrences) or at close proximity (12 occurrences) inthe sequences. Both properties should result in strongelectrostatic repulsions, promoting an extended confor-mation ... induce local rigidity in the polypeptide chain.However, in certain speci c cases, localized proteinregions must remain nonfolded to fulﬁll their biologi-cal functions. Linkers found in carbohydrate-activeenzymes...

Tài liệu Báo cáo khoa học: How disorder inﬂuences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce ahexahistidine tag and a ClaI restriction site at nucleotideposition –6 and a reverse primer (5 ¢-A TCGCCATGGTCCCGGGCATATGGGATCCCTGGAAGTACAGGTTTTCGCCATGCTCTTGATCCC-3¢) ... (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to insert a ClaI restric-tion site at nucleotide position )6, whereas the reverseprimer (5¢ -ATCGCCATGGTCCCGGGCATATGGGATCCCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTCCC-3¢) ... (FWN1:5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATAC-3¢),designed to introduce a ClaI restriction site at nucleotideposition –6 and a reverse primer (REVN1:5¢-CCTGCCATTGCTTGCAGCC-3¢) that introduced...

Tài liệu Báo cáo khoa học: "How Phrasing Affects Memorability" ppt

... LeeDepartment of Computer ScienceCornell Universitycristian@cs.cornell.edu, jc882@cornell.edu, kleinber@cs.cornell.edu, llee@cs.cornell.eduAbstractUnderstanding the ways in which informationachieves ... are consistent withmemorable text.The fact that it’s not clear how to construct a col-lection of “non-memorable” counterparts to slogansappears to pose a technical challenge. However, wecan ... Prediction: SVM 10-fold cross validation resultsusing the respective feature sets. Random baseline accu-racy is 50%. Accuracies statistically signiﬁcantly greaterthan bag-of-words according...

Tài liệu Báo cáo khoa học: "How Are Spelling Errors Generated and Corrected? " docx

... steps (Cf. Figure 1):• To recover the post-correction string, wedeleted the same number of characters preced-ing a sequence of backspace keys.• To recover the pre-correction string, we com-pared ... Trans-positionVowel / ConsonantInsertionInserted Character0.0 0.4 0.8 C > ;C C−>V V−> ;C V−>VSubstitutionSubstituted Character −> Correct Characteren_keystroke ja_keystrokeen_commonFreq./max(Freq.)0.0 ... the pre- and post-correction strings from them.By learning the characteristics of corrected and un-corrected errors, we can expect to use the data forimproving the correction of the errors...

Tài liệu Báo cáo khoa học: "How spoken language corpora can reﬁne current speech motor training methodologies" pptx

... recorded its structure,frequency rank, and the articulatory characteristicsof its consonants. Next, we describe the speechitems selection tool for clinicians.Figure 1: Syllable frequency ... SpokenDutch Corpus (CGN). All the resources includedmanually veriﬁed syllabiﬁcation transcriptions. A10-fold cross validation on each of the corpora wasperformed to evaluate the accuracy of our ... and low frequency.• Voiced - Unvoiced consonant6• Manner of articulation7• Place of articulation8Once the user selects a syllable type, he/she canfurther specify each consonant within...

Tài liệu Báo cáo khoa học: "HOW DO WE COUNT? THE PROBLEM OF TAGGING PHRASAL VERBS IN PARTS" docx

... nava@nynexst.com ABSTRACT This paper examines the current performance of the stochastic tagger PARTS (Church 88) in handling phrasal verbs, describes a problem that arises from the statis- tical ... average performance of the tagger as claimed in Church 88. Yet we notice that simply assigning a verbal tag to all pairs ac- tually degrades performance because in some cases the content word ... out of 102 occurrences in the Brown Corpus), it will not only influence but will ac- tually override the contextual probability, which might suggest a different assignment. In the case of to...

Tài liệu Báo cáo khoa học: "HOW TO MISREAD A DICTIONARY" pot

...

Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane afﬁnity and hyper-anticoagulant activity in mouse plasma pptx

... response (i.e. occurring when all receptor sites areoccupied) that will be approached by a speci c analyteconcentration speciﬁed by the KDof the receptor–ana-lyte interaction. This was clearly not ... Clinical Chemistry Section, Department of Morphological-Biomedical Sciences, University Hospital of Verona, ItalyIntroductionProtein C is a vitamin K-dependent c- carboxyglutamicacid-containing ... min. Ca2+concentration (mM) is indicated near the appropriatecurve. The SPR response curves are shown after background cor-rection using a 100% POPC control ﬂow cell. Binding to the controlsurface...

Tài liệu Báo cáo khoa học: The cartilage-speciﬁc transcription factor Sox9 regulates AP-2e expression in chondrocytes pptx

... mutSox9-447_for, 5¢-CCAGAAGGCGGCTCTGATTGCTGTGGGCTGAATTCACGC-3¢; and mutSox9-447_rev, 5¢-GCGTGAATTCAGCCCACAGCAATCAGAGCCGCCTTCTGG-3¢.A K. Bosserhoff et al. Sox9 regulates AP-2e in hypertrophic chondrocytesFEBS ... performed using speci c primers: AP-2e-for, 5¢-GAAATAGGGACTTAGCTCTTGG-3¢, and AP-2e-rev, 5¢-CCAAGCCAGATCCCCAACTCTG-3¢ (annealing temperature 59 ° C) ; AP-2a-for, 5¢-GATCCTCGCAGGGACTACA-3¢, and AP-2a-rev, ... themesenchymal cells to chondrocytes causes a change inECM composition. Chondrocytes express cartilage-speci c type II, type IX and type XI collagen,proteoglycans, aggrecan, and cartilage-derived...

Xem thêm