0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... cerevisiae, is classified as a member of the phos-phatidylethanolamine -binding protein family. The binding of ICto phos-pholipid membranes was first analyzed using a liposome -binding assay andby ... Crystallization and preliminary X-rayanalysis of carboxypeptidase Y inhibitor ICcomplexedwith the cognate proteinase. Acta Crystallogr D 60,1622–1624.J. Mima et al. Membrane binding of ... cellular localiza-tion of IC–GFP at the vacuolar membranes andlumens during the stationary growth phase, suggestingthat ICis specifically associated with the vacuolarmembranes rather than the...
  • 10
  • 645
  • 1
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

... loose a ssociation for the peptidein the membrane bilayer.Self-assembly can also b e analyzed by compositionalvariation of rhodamine-labelled p eptide, keeping the totalconcentration of labelled ... sample, the 45° germanium ATR-plate (2 · 5 · 50 mm) wascleaned by a plasma cleaner (Harrick, Ossining, N Y, USA). Analysis of ATR-FTIR data was performed inaccordance with a previous study [21].NMR ... revent the FP from immersing too d eeply into the apolar core of the membrane. Our data are alsocompatible with the observation that truncation of t he membrane- spanning region of HA2 to the extent...
  • 12
  • 589
  • 0
Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf

Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf

... 78911615141312111023456789B A CGGCCC +RNA0–+RNA1+RNA2 +RNA3 +RNA4 +RNA5C––RNA1 –RNA2 –RNA3 –RNA4 –RNA5CGGCC +RNA1CGGC +RNA2CGG +RNA3C +RNA4+RNA5ACCTCGTATAC –RNA0ACCTCGTATA –RNA1ACCTC –RNA2ACC –RNA3AC ... condition of a fixed amount of the NS5B and the radiolabeled +RNA0 in the presence of increasing a mount of competitor, the unlabeled +RNA0. The EMSA showed that RNA of the RNA–NS5B complex specifically ... in the presence of radiolabeled CTP. The reaction prod ucts were analyzedon an agarose g el. As expected, the newly synthesized RNAfrom the RNA polymerization containing +RNA1 and+RNA2 was...
  • 9
  • 560
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... 239rTAATACGACTCACTATAGGGGCACGCCCAAATCTC239 5’S2 GCCAGCCCCCTGATGGGGGCGA(–)IRES 219r AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC219 5’S2 GCCAGCCCCCTGATGGGGGCGA(–)IRES 104r AAATAATACGACTCACTATAGACACTCATACTAACGCCATG104 ... 5’341T7TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT(–)IRES DSLA1 GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACGDSLA1 5’341T7TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT(–)IRES DHp2s TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCTDhp2 ... TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGALDH2 CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTTLDH2r AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGGTCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA(–)IRES 239rTAATACGACTCACTATAGGGGCACGCCCAAATCTC239...
  • 15
  • 597
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... protein crystallography. Acta Crystallogr D Biol Crystallogr 50,760–763.31 Vagin A & Teplyakov A (2000) An approach to multi-copy search in molecular replacement. Acta CrystallogrD Biol Crystallogr ... Using a thermal-melt assay, a nucleo-tide metabolome library was screened against PRTFDC1 and revealed thathypoxanthine and guanine specifically interacted with the enzyme. It wassubsequently confirmed ... Biochemistry 45, 6615–6627.24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthineguanine phosphoribosyltransferase expands substratespecificity. Arch...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... the catalytic activity of OTUB1 and its ability to stabilize the active form of RhoA prior to invasion. YpkA and OTUB1 modulate the stability of RhoA in opposing ways, thereforeleading to cytoskeletal ... anddemonstrate a physiological role of the deubiquitinat-ing enzyme OTUB1 in Yersinia invasion. OTUB1 as a potential key player in regulating RhoA stability mayrepresent a novel pharmacological target ... mimickingphosphorylation appear to have similar biochemicalproperties as the naturally occurring 37 kDa form of OTUB1, in particular the S18E and Y2 6E variants,both of which exert increased affinity to YpkA....
  • 16
  • 654
  • 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

... taken from [44].ChickenH101 a- STAAPP AmKA K A K A T K K K 2m ⁄ fKK dNKH110 a- STAAPA AK A K A K AT K KK 2m ⁄ fKK dNKH102 a- STAAPS AK A K P K ATK KK 2m ⁄ fKK dNKH103 a- A pTAAPA AK A K A K ATK ... DKH1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aKH1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afKH1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a K ufKK a ⁄ mKN afKH1.4 a- pS pTAAPK pTKKK ... pSS auK aK fK aKK NaKH1.3 a- STAAPaK pTKKK RaK pSS auK aK fK a KK NaKH1.4 a- STAAPaK pTKKA RaK pSS auK aK fK aKK NaKH1.5 a- pST A E P aK pSKKK RK TSaK K K K K N afKChickenH101 aKKR RTAaKK pSKKTKK...
  • 13
  • 633
  • 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... synthesisSqualeneCholesterolHMG-CoA reductaseSREBP-2NADPHPyruvateAcetyl-CoACitrateacetyl-CoAOxaloacetateOxaloacetateACLACCHMG-CoAHMG-CoA synthaseCitrateMalonyl-CoAPalmitateMalateMitochondriaFASACCSCDFatty ... dehydrogenase; PK,pyruvate kinase; ME, malic enzyme; ACL,acetyl-CoA lyase; ACC, acetyl-CoA carboxyl-ase; FAS, fatty acid synthase; SCD, stea-royl-CoA desaturase; GPAT, glycerolphosphate acyltransferase; ... Shimano H, Nakakuki M, Matsuzaka T,Nakagawa Y, Yamamoto T, Sato R, Takahashi A, Sone H, Yahagi N et al. (2005) Lipid synthetic tran-scription factor SREBP- 1a activates p21WAF1 ⁄ CIP1, a universal...
  • 6
  • 574
  • 1
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... T, Maruy-ama M, Saito M, Yamada M, Takahashi H & Tsuji S(1999) A neurological disease caused by an expandedCAG trinucleotide repeat in the TATA -binding protein gene: a new polyglutamine ... by the fact that an aberrant version of TBP cau-ses spinocerebellar ataxia [40] and the lack of TBP byhomologous recombination leads to growth arrestand apoptosis at the embryonic blastocyst ... con-tained in the database did not form subgraphs andappeared isolated. The relatively small size of the con-nected graph compared with all the entries in the data-base might be due, at least...
  • 12
  • 511
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ