0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: Caveolin-1 influences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx

Tài liệu Báo cáo khoa học: Caveolin-1 influences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx

... fromCaveolin-1 cDNA are GCAAGTGTACGACGCGCAC and AACCAGAAGGGACACACA, respectively.As negative controls (scrambled shRNAs), shRNAcontrol1(TAGCGACTAAACACATCAA), shRNAcontrol2(TATAGCGACTAAACACATCAA) and ... rafts are microdomains of the plasmamembrane containing a high proportion of sphingo-lipids and cholesterol, assembled in the Golgi apparatus and subsequently delivered to the plasma membrane[16]. ... nontreated mem-branes (–). Full deglycosylation of the 80 kDa band was indicated by a reduction in molecular mass of approximately 12 kDa to 68 kDa. The mass of the 60 kDa band was unaffected...
  • 13
  • 440
  • 0
Tài liệu Báo cáo khoa học: Key role of the loop connecting the two beta strands of mussel defensin in its antimicrobial activity docx

Tài liệu Báo cáo khoa học: Key role of the loop connecting the two beta strands of mussel defensin in its antimicrobial activity docx

... (i.e. the b-hairpin loop and part of the adjoining b-sheet) and residues in the loop connecting b-strand and a- helix and contiguous residues on the a- helix and the last part of b-strand 3Õ [35]. ... membrane. The way this contacttakes place and the molecular features of the proteininvolved are yet to be deciphered. The lack of informationabout the mode of action and the availability of a ... compared with results obtained by other groupswho also point to the role of the connecting loop of the b-hairpin of defensins. A combination of mutationalanalysis [35] and structural analysis of...
  • 9
  • 598
  • 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... 2815(5¢-CCGAGCTCGAGACGTGAAGCGACAATCTCGCAATCT-3¢) containing an XhoI (Promega) site upstream of the start codon and an antisense primer (5¢-CAGCCAAGCTTCTCACTCTTTGATGAAATGCATCT-3¢) con-taining a HindIII ... Takashi Isobe1, Takeshi Arakawa2,Yasunobu Matsumoto3 and Naotoshi Tsuji11Laboratory of Parasitic Diseases, National Institute of Animal Health, National Agricultural Research Organization, ... 2003Inorganic pyrophosphatase in the roundwormAscaris and its role in the development and molting process of the larval stage parasitesM. Khyrul Islam1, Takeharu Miyoshi1, Harue Kasuga-Aoki1,...
  • 13
  • 691
  • 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... considered asfollows. The role and importance of the aspartate in the catalytic triad is not fully understood because several serineproteases do not have an aspartate as the catalytic apparatus.However, ... dependence; the acidic rim is at pK a ¼ 6.5 and the Fig. 1. Stick models of the reactive site in bovine trypsin and API. The catalytic triad residues of trypsin and API are Ser195–His57–Asp102 and Ser194–His57–Asp113, ... pair functions in the high catalytic activity of thisprotease at pH9 [10]. Further interest in the aromaticstacking is in the role of the electrostatic properties in enzymatic catalysis of API,...
  • 7
  • 603
  • 0
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

... beta- and gamma-catenins in their cytoplamic tails. As with tightjunctions, adherens junctions are linked to the actincytoskeleton via the binding of beta- and gamma-cate-nin to alpha-catenin ... in ammatoryresponses [85]. In addition, the slight edema of astro-cytes helps maintain the water balance in the brain,but pathologic cytotoxic edema is a main cause of increased intracranial pressure [86]. ... vas-culature, because they regulate the formation and main-tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. In thisminireview, we focus on the active functions...
  • 14
  • 580
  • 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

... qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78,AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C (C) are presented ... to increase again at peak vitellogenesis(18 + 24 h PBM). These transcripts (AaUSP -A, AabFTZ-F 1A , AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) werealso analyzed in our in ... profilematching both replicates.An increase in transcript abundance for AaEcRA,AaEcRB, AaE7 5A, AaE75B, AaE75C, AaHR3,AaHR4, AaE78 and AaHR39 occurred in both tissues,correlating with the known...
  • 22
  • 578
  • 0
Tài liệu Báo cáo khoa học: Electrostatic contacts in the activator protein-1 coiled coil enhance stability predominantly by decreasing the unfolding rate docx

Tài liệu Báo cáo khoa học: Electrostatic contacts in the activator protein-1 coiled coil enhance stability predominantly by decreasing the unfolding rate docx

... the identifiable states of the folding pathway and relate to the amount of solvent-exposed surface area in each of these states (see Materials and methods). This can bedone for all five states in the ... study, it was ascertained that the firstreaction phase was fast and concentration dependent,showing that the intermediate was readily populated and dimeric. The second phase was independent of concentration ... kcalÆmol)1 of increased stability). This wasevident in the folding pathway for the Arg-Glu mutantvia both a slightly faster folding rate and a vastlydecelerated overall unfolding rate, relative to the...
  • 14
  • 539
  • 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx

... cellular ceramide are regulated by the de novo pathway and the recycling pathway. The formerrelates to the synthesis of ceramide through the conden-sation of palmitate and serine in a series of ... mutations.AcknowledgementsThis research was supported in part by the IntramuralResearch Program of the National Institute on Aging,National Institutes of Health, Department of Health and Human Services; Annual Report ... of the substantia nigra. In addition,typical PD cases have intracellular proteinaceous inclu-sions called Lewy bodies and Lewy neurites in the brainstem and cortical areas.Genetic research in...
  • 7
  • 652
  • 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... organizationRoles of the Las17p (yeast WASP)-binding domain and a novelC-terminal actin-binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. Vajjhala4 and ... and immunoblotted with an anti-actin mAb (left). Equivalentamounts of purified yeast actin were used in each binding assay and an amount representing 10% of the load used in each binding assay ... consistentwith a role of F-actin and ⁄ or actin polymerization in the generation or maintenance of a polarized distribu-tion of cortical patches.Las17p and type I myosins promote the assembly of actin...
  • 23
  • 679
  • 0
Tài liệu Báo cáo khoa học: Fermentative lifestyle in yeasts belonging to the Saccharomyces complex ppt

Tài liệu Báo cáo khoa học: Fermentative lifestyle in yeasts belonging to the Saccharomyces complex ppt

... circumscription of Saccharomyces, Kluyveromyces and other members of the Saccharomycetaceae, and the proposal of the newgenera Lachancea, Nakaseomyces, Naumovia, Vanderw-altozyma and Zygotorulaspora. FEMS ... due to amino acid biosynthesis. Much of the generation of NADH during amino acid biosyn-thesis takes place in the mitochondria. Because of the block in the respiratory chain caused by the addition of ... hemoproteins, NAD, and uracil [7,8]. The abil-ity to translocate ATP produced in the cytoplasm intomitochondria, and the ability to adjust the redox bal-ance, play a very important role in independencefrom...
  • 14
  • 626
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ