Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin1, Martin Welin2,*, Liya Wang1 and Staffan Eriksson11 Department of Anatomy, ... inGTP activation. F133 was mutated to Asn in anattempt to create a GTP-activated enzyme, and F13 3A was prepared and tested as a control. Neither of theUpUMPK mutants F133N and F13 3A were activatedby ... 600 [UMP] /µM800 1000 1200Fig. 9. Substrate saturation curves of UpUMPK mutant enzymes:F133N and F13 3A with UMP as variable substrate. UMP kinase from Ureaplasma parvum L. Egeblad-Welin et al.6410...
- 12
- 656
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and X-ray crystallography.Biochemistry ... HPRT and several bacterial and protozoan HPRTs have been undertaken [1 3–1 7]. Thestructure of human HPRT can be divided into twodomains: a core domain and a hood domain [14,18].The HPRTs have a ... filter paper assay and tritium-labeledsubstrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. kcatwas calculated usingMw(HPRT) = 27132 Da and...
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf
... 50 and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated kon and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity ... done toobtain measures of Keq A and the associated k1 and k2values for dual-flavin enzymes, particularly when theyare poised in all catalytically relevant intermediateredox states (1-, 2-, ... with CaM variants[60,8 6–8 9,10 6–1 10] indicate that several structural fea-tures of CaM may be important. However, the recentresults of Ilagan et al. [63] suggest that CaM bindingmay not alter...
- 16
- 639
- 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx
... used in place of MR. NADH4 and NADPH4are prepared by maintaining a slight pressure($1.2 bar) of hydrogen (> 99%) over a solution of NAD(P)H (500 mg) and palladium-activated charcoal(30 mg) ... substrate-binding titrations and crystallo-graphic studies when a very large amount of the sub-strate may be required; typical NAD(P)H saturationconstants for OYEs are 0.1-1 mm and as an example, a ... cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions may be a large reorganization energy.The...
- 12
- 595
- 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc
... cysteines located in both of the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in theattachment of PsaC [12]. PsaC, PsaD and PsaE arelocated at the cytosolic site (Fig. 1A) [2,7,1 3–1 6]. ... M, Aoki S,Sato D, Kobayashi T, Kita K, Horii T & Hase T(2007) Cloning and characterization of ferredoxin and ferredoxin–NADP+reductase from human malariaparasite. J Biochem 141, 42 1–4 28.154 ... chloroplast preparations. J Biol Chem195, 7 5–9 3.4 Arakaki AK, Ceccarelli EA & Carrillo N (1997) Plant-type ferredoxin–NADP+reductases: a basal structural framework and a multiplicity of functions....
- 17
- 634
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of ... The core of the pro-tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.5856 ... Katz JE, Beasley S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... sites using a forwardoligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence ... chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of 81 000 A ˚2with 30% ( 24 000 A ˚2) as con-tact area. ... Gly-Gly-Cyssequence was introduced at the C-terminus using oligomers5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21cells were transformed...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... revealing a remarkable increase in contactbetween the prostate carcinoma cells and the stromalcells, which is critical for prostate cancer progression and metastases [66]. As human prostate cancer ... S & Chott A (2000) Platelet-derived growth factor-AA and – alphareceptor expression suggests an autocrine and ⁄ or para-crine loop in osteosarcoma. Mod Pathol 13, 63 2–6 37.92 Antoniades ... tolung, prostate and ovarian cancers. Both PDGF-C and -D play a role inprogressive renal disease, glioblastoma⁄ medulloblastoma and fibrosis inseveral organs.AbbreviationsCNS, central nervous...
- 19
- 557
- 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... thecloning and functional characterization of an AK gene from a genomic library of L. donovani as well as its expression and molecular characterization.Materials and methodsMaterialsPlasmids pGEM-3Zf(+) ... Molecular and functional characterization of adenylate kinase 2gene fromLeishmania donovaniHe´ctor Villa1, Yolanda Pe´rez-Pertejo1, Carlos Garcı´ a- Estrada1, Rosa M. Reguera1, ... Fukami-Kobayashi, K., Nosaka, M., Nakazawa, A. & Go, M.(1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphatekinase...
- 9
- 487
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); thirdset, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATGCAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCAGATAC-3¢) (Fig. 1C). ... (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGATCACC-3¢), respectively. The PCR ... 3228 1–3 2287.31. Itadani, H., Nakamura, T., Itoh, J., Iwaasa, H., Kanatani, A. ,Borkowski, J., Ihara, M. & Ohta, M. (1998) Cloning and char-acterization of a new subtype of thyrotropin-releasing...
- 11
- 506
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinBT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP