Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... Pediatric Research Unit, CRCHUL ⁄ CHUQ, Faculty of Medicine, Laval University, Que´bec, Canada2 Quebec Proteomic Center, CRCHUL ⁄ CHUQ, Faculty of Medicine, Laval University, Que´bec, Canada3 Cancer ... Pozzi N, Tamasi S& Pignata C (1998) Occupancy of dipeptidyl peptidase IVactivates an associated tyrosine kinase and triggers anapoptotic signal in human hepatocarcinoma cells. Hepa-tology ... (2 6C) IgG.AcknowledgementsThis work is supported by the Natural Sciences andEngineering Research Council (NSERC) of Canada(RF: OGPO157551), by the Canadian Diabetes Associ-ation (CDA) and a...
- 12
- 738
- 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... 2007 The Authors Journal compilation ª 2007 FEBS 6351 Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c Chief and corroborative ... interactions. Simultaneous mutation of theseresidues to Ala eliminated activity in binding to a BPA molecule, and individual mutations drasticallyreduced the activity. Because Ala lacks the character-istic ... activ-ity was assayed by using Great EscAPeä SEAP assayreagent (Clontech Laboratories) according to the Fluores-cent SEAP Assay protocol. Light emission was measuredon a microplate reader Wallac 1420...
- 12
- 583
- 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf
... pyloriCCUG17874 genomic DNA using the following primers:forward, 5¢-CACCAAACCTTATACGATTGATAAGGCAAAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCTTCTAG-3¢. The construct was cloned directly into the pET151 ... of chain A is close to Asn77 of chain B, then Asn77 of chain A isclose to Ala25 of chain B.Chain A Chain B Hydrogen bondsAla25 Asn77, Arg80 AlaO–ArgNH1AlaO–ArgND2Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1AsnOD1–HisNE2Ser28 ... loop that connects strands F and G of subunit B (cyan and pale blue) partially covers the entrance of the protein central cavity. (C) Electrostatic potential surface of the pro-tein calculated...
- 10
- 768
- 0
Tài liệu Báo cáo khoa học: Oocyte membrane localization of vitellogenin receptor coincides with queen flying age, and receptor silencing by RNAi disrupts egg formation in fire ant virgin queens ppt
... VgR–dsRNA1 sequence) [36] was amplified astemplate with primer set VgRi-f4 (5¢-TAATACGACTCACTATAGGGCGTGATCAGGTCAAAACGTATTTTCTTCATTT-3¢) and VgRi-r3 (5¢-TAATACGACTCACTATAGGGGCCACAGTCAT CCTTTT TATCG ... (5¢-TAATACGACTCACTATAGGGGCCATCTGCAATTATCAACGCCTTTCTTAACGTC-3¢) and VgRi-r1 (5¢-TAATACGACTCACTATAGGGACCACATACTGTGCATCGCGTGAATAAGGTGTC-3¢),which included the T7 promoter region (underlined). The PCR conditions were 94 C for 3 min ... Zeiss).RNAi A SiVgR clone was used as a template for the synthesis of a 691 bp region of the SiVgR gene (amino acid 648–878)using primer set VgRi-f1 (5¢-TAATACGACTCACTATAGGGGCCATCTGCAATTATCAACGCCTTTCTTAACGTC-3¢)...
- 14
- 482
- 0
Tài liệu Báo cáo khoa học: Calcium-binding to lens bB2- and bA3-crystallins suggests that all b-crystallins are calcium-binding proteins pptx
... CA (1981) Hypocalcaemiccataract. In Mechanisms of Cataract Formation in the Human Lens (Duncan G, ed.), pp. 219–236. AcademicPress, New York, NY.44 Duncan G & Jacob TJ (1984) Calcium and ... their function as calcium buffersbecause they are not expected to transduce signals ascalcium sensors by conformational change upon cal-cium -binding. All b-crystallins are calcium -binding proteinsWe ... Stains-All assayCalcium -binding to bB2- and bA3-crystallins was eval-uated by calcium probe Stains-All, a carbocyanine dye[29]. The dye binds the recombinant bA3- and bB2-crystallins and induces...
- 13
- 449
- 0
Tài liệu Báo cáo khoa học: Covalent binding to glutathione of the DNA-alkylating antitumor agent, S23906-1 doc
... glutathione; DNA alkylation; acronycine; anti-cancer drug; mechanism of action.Introduction The alkaloid acronycine (Fig. 1) was first isolated from the bark of Acronychia baueri (also known as ... alkylate the genomic DNA in cells. The amount of drug–DNA covalentcomplexes in cells can be estimated by fluorescence meas-urements, taking advantage of the speci c fluorescence of the benzoacronycine ... potent anticancer drugwith activity against a variety of human tumor xenograftmodels in mice [9,10]. S23906-1 has been selected for advanced preclinical evaluation.From a mechanistic point of...
- 12
- 701
- 0
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf
... process of the parasite infective cycle, favouring the appearance of resistant mutants which are easily spread in areas under chemotherapeutictreatments. Maslinic acid (MA) is a low toxic natural ... processes with a single compound, a new concept in antimalarial research.IntroductionAs long as effective vaccines against malaria remainunavailable, the search for new antimalarial drugs isstill ... Zinc chelating assay for MA. Percentage of zinc chelationdetected using Eriochrome Black T as an indicator of non-com-plexed zinc cations. The assay was carried out by adding differentamounts...
- 11
- 682
- 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
... relative decrease in the number of studies aimed at gaining an understanding of the structural conformation of chromatin, and the changes in chromatin structure that accompany geneactivation. Furthermore, ... CGTF?DNMT3LCfp1CXXCSet1DNMT3Tet2CGKDM 2A CXXCMeH3K36CCCCGCCCCSp1Pol IISet1TAFTFIIBOHMeCGTet2Fig. 6. Models depicting the factors that actin concert to maintain either an active or a repressed state at CG islands. ... understanding of the significance of the differentdegrees of chromatin condensation and chromatinmodification that prevail in the nucleus, that enable the appropriate activation of speci c gene loci....
- 29
- 743
- 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... AGUAGUAAUGGUCC-GUCAUAAUhsa-miR-20 0c 3´ AGGUAGUAAUGGGCC-GUCAUAAUsite 2: ZEB1 3´ UTR 5´ AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCCGUCAUAAUhsa-miR-20 0c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- ... UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a 3´ CGAGUAGUUUCGACCGACACUAUdme-miR-2b 3´ CGAGGAGUUUCGACCGACACUAUdme-miR-11 3´ CGUUCUUGAGUCUGACACUAC K-box family miRNAsNotch ... EcR 3´ UTR 5´ AACACGCAAAACUUGGACUGAU |||||| dme-miR-14 3´ AUCCUCUCUCUUUUUCUGACUsite 2: EcR 3´ UTR 5´ AUAAUGAAAUGAAAGUGAUUGGA || |||| || ||dme-miR-14 3´ AUCCUCUCU-CUUUUUCUGACUUGGCHh...
- 9
- 684
- 0
Tài liệu Báo cáo khoa học: Glycomics-based analysis of chicken red blood cells provides insight into the selectivity of the viral agglutination assay docx
... completed additional MS andNMR-based analysis of the cRBC glycan pool. Inaddition to identification and quantification of othermonosaccharides, we aimed to characterize the overallsialic acid content, ... sialic acid cleavage,whereas there was the appearance of new peaks atretention times in the range 5–55 min (indicating sialicacid cleavage). Integration of the areas under the curves for each ... GlcNAc-5, GlcNAc-5¢, galactose (Gal)-6,Gal-6¢ and Gal-8 appear in the range 4.40–4.75 p.p.m.(Table S1). Specifically, the anomeric proton of GlcNAc-2 appears at 4.62 p.p.m.; the GlcNAc-5 andGlcNAc-5¢...
- 14
- 811
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI