Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Journal compilation ª 2007 FEBS Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP 1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting ... mitochondrial targeting of CYP2E1 Naresh B. V. Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G. AvadhaniDepartment of Animal Biology, School of Veterinary Medicine, University of ... thatxenobiotic-inducible CYPs such as rat CYP 1A1 , CYP2E1 and CYP2B1, and mouse CYP 1A1 , containchimeric noncanonical -targeting signals that are capa-ble of targeting proteins to both the ER and mitochon-dria...

... resultant binding and selective alkyla-tion leading to a depletion of mtDNA in intact cells(Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating ... Biotech).MtDNA was prepared from isolated rat liver mitochon-dria (40 mg protein) using a plasmid spin miniprep kit(Qiagen) at a ratio of 5 mg mitochondrial protein percolumn. The initial alkaline ... entirely wrap mtDNA and cause a markedincrease in nuclease resistance in vitro [54]. Similar targeting of PNAs to mitochondria also failed to showinhibition of mtDNA replication in intact cells...

... FEBS 3759IntroductionC-peptide is derived from most of the proinsulin seg-ment in between the B and A chains of insulin [1] and has an important structural role in the proper folding and disulfide ... observation that self-asso-ciating peptides and proteins are at the core of severalneurodegenerative diseases has led to a massive effortaiming to understand the physiologically relevantstructures ... formation of proinsulinC-peptide is affected by metals and insulin.Prosinsulin C-peptide oligomer formation as a function of time (A) . C-peptide was incu-bated for the indicated time and analyzedunder...

... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (199 8) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect ... studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin antisense) [19]Identification of M. catarrhalis lpxX and lpxL S. Gao et al.5206 FEBS Journal ... ATG AGC CTA CCA (atr sense) This studyatr2 TGC TGA TGA TGG CAA CTC (atr antisense) This studyasd1 AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This...

... for the attachment, capture and destruction of invading microorganisms. The NETs contain nuclearmaterials that include DNA and bactericidal proteins and histone-derived peptides such as buforins ... nonpeptidesH4-(86–10 0) and HNr (Fig. 1) were tested for theirbactericidal activity against Gram-negative and Gram-positive bacteria (Table 1). The bactericidal activities of HNr and H4-(86–10 0) were comparable, ... inactive HN fragments, in the antimicrobial assayFig. 3. Effects of the uncoupler of oxidative oxidation DNP (A, B), the aconitase inhibitor fluoroacetate (C, D) and the inhibitor of DNA gyrase-linked...

... sequencesyef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAAATGAAAACTGATAGATTACTGyef1-attB2R AGAAAGCTGGGTGGATTGCAAAATGAGCCTGACattB1 ACAAGTTTGTACAAAAAAGCAGGCTattB2 ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII...

... recentadvances on the biochemical and structural characterization of the proteins involved in translocon formation, as well as their participation in the modi-fication of intracellular signalling ... membrane proteins (the hydropho-bic translocators) and one hydrophilic partner (alsocalled the V antigen in Pseudomonas aeruginosa and Yersinia spp.; Figs 1 and 2) comprise the translocon, and are ... Hamaguchi M, Hamada D, Suzuki KN, Sakata I &Yanagihara I (200 8) Molecular basis of actin reorgani-zation promoted by binding of enterohaemorrhagicEscherichia coli EspB to alpha-catenin....

... Ltd. The targeting sequence of the siRNAagainst rat TRAP1 was 5¢-CAACAGAGATTGATCAAAT-3¢. A negative control adenovirus vector containingnonspecific siRNA was constructed in the same way (non-specific ... protein 1 (TRAP 1) is a mito-chondrial chaperone that plays a role in maintaining mitochondrial func-tion and regulating cell apoptosis. The opening of the mitochondrial permeability transition ... in cardiomyocytes in terms of bothviability and cell death after TRAP1-siRNA infection(Fig. 6A, B).MPTP mediates the TRAP1 effectTRAP1 is a mitochondria chaperon and plays a role in maintaining...

... adenylate kinase to preventdepletion of available ATP and ADP and to maintainsteady-state respiration. Instead, we did a theoreticalcalculation of the extramitochondrial AMP concentra-tion ([AMP]out ) ... (5 and 10 lm)affects the ATPtotal⁄ ADPtotalratio and [AMP]total in actively phosphorylating (state 3) mitochondria respir-ing on succinate and compared the experimental and calculated values ... to acti-vation of AMPK cannot lead to production of ATPbecause of lack of mitochondrial ADP. As AMPK sti-mulates cellular fatty acid uptake [29] and the availab-ility of circulating fatty acids...

... The role of the ESSS protein in the assembly of a functional and stablemammalian mitochondrial complex I (NADH-ubiquinoneoxidoreductase)Prasanth Potluri, Nagendra Yadava and Immo ... Inspection of the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant ... number of differ-ences in the N-terminal domain (located on the matrix side).It is likely that the N-terminal domain is involved in protein protein interactions with other hydrophilic domainsof...