Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

... PC1⁄3, PC2 and PC5⁄ 6A are targeted to dense core secretory granules by a common mechanism Jimmy D. Dikeakos1, Chantal Mercure1, Marie-Jose´e Lacombe1, Nabil G. Seidah2 and Timothy ... ª 2007 FEBSis autocatalytically cleaved, a central catalytic domaincomprising the catalytic triad of amino acids asparticacid, histidine and serine, and a stabilizing P-domaininvolved in ... series ofmaturation steps that include processing of hormoneprecursors, condensation to form a dense core, and docking at the plasma membrane. Because dense core secretory granules are released from...

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

... disease. Lancet Neurol 7,97–109.4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai- to M, Maruyama M, Takahashi T, Ozawa T, Tsuji S &Takahashi H (2000) An autopsy case of autosomal-recessive ... Speciﬁcally, this association ismediated by pathogenic DJ-1 mutations and oxidativestress [76]. These data suggest a link DJ-1 and Parkin in a common pathway in mammals. A described case ofautosomal-recessive ... In addition, preliminary evi-dence by Valente et al. [12] suggested that PINK1protected mitochondria and cells against stress.DJ-1 (PARK 7)Mutations in PARK7 are associated with AR-JP and are...

Tài liệu Báo cáo khoa học: The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes doc

... 5¢-GACGAAATGACTGTTTCTTTGAGCCTTTTCGTACCCC-3¢; (d) COX-2 promoter Ets site #4,5¢-AGGGGAGAGGAGGGTTAAATTTGTGGGGGGTACGAAAAGGCGG-3¢; (e) COX-2 promoter Ets site #5:5¢-GGGTTTTTTACCCACGCTAATGAGAAAATCGGAAACC-3¢.DNA ... expression by CpG DNA:role of NF-kappaB and p38. J Biol Chem 278, 22563–22573.15 Teruyama K, Abe M, Nakano T, Iwasaka-Yagi C,Takahashi S, Yamada S & Sato Y (2001) Role of tran-scription factor ... enhanced by cooperation with other transcription factors such as nuclear factor-jB and nuclear factor of activated T cells. Neutralization of COX-2 is the goalof many anti-inﬂammatory drugs. As...

Tài liệu Báo cáo khoa học: Identiﬁcation of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... using an ECL kit. Fordensitometric analysis, data were captured using a FujiLAS-1000 Imaging System CCD camera (aida 2.11 soft-ware for analysis).ACE2 ⁄ ACE activity assaysFluorogenic assays ... bicincho-ninic acid assay with BSA as standard [30].PNGase F treatmentPNGase F treatment (New England Biolabs, Beverly, MA,USA) was performed according to the manufacturer’sinstructions.Critical active-site ... which are sensitive to anion activation [4,17,18]. However, unlike ACE,ACE2 functions as a carboxypeptidase and is not sus-ceptible to inhibition by the classical ACE inhibitors[1,2]. After...

Tài liệu Báo cáo khoa học: Oxidized elaﬁn and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf

... [30] to obtain cDNAs encoding M25L–elafin and M63L–trap-pin. For this purpose, forward primers 5¢-CGACTCGAGAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGACTCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ wereused for amplification ... NE and Pr3 by native and oxidized elafin and trappinNE and Pr3 are both able to solubilize fibrous elastin[19]. We used remazol-Brilliant Blue (RBB)–elastin to investigate their elastolytic activity ... inhibitor) hasanti-microbial activity against Gram-positive and Gram-negative respiratory pathogens. FEBS Lett 452, 309–313.13 McMichael JW, Maxwell AI, Hayashi K, Taylor K,Wallace WA, Govan...

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... an exciting area of research and poten-tially a therapeutic avenue to treat obese and diabeticpeople. Manipulating metabolic pathways for the treat-ment of disease has once again placed basic ... Thus,the brain can directly sense and respond to changes in nutrient availability and composition to affect body weight and adiposity.AbbreviationsACC, acetyl-CoA carboxylase; AMPK, 5¢ AMP-activated ... trans-ferred back to coenzyme A via the malonyl-CoAinsensitive CPT2 [41–45].There are at least six carnitine acyltransferases inmammals [46]. Carnitine acetyltransferase and carni-tine octonyltransferase...

Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx

... bound to pantoateCocrystallization trials of nPS with pantoate wereperformed over a range of pantoate concentrations.Crystals of the nPS–pantoate complex obtained at50 mm pantoate diffracted to ... to a network of water moleculesthat are hydrogen-bonded to the O1 atom of pantoatein site I. The O4 atom of pantoate in site II and theO1 atom of pantoate in site I are hydrogen-bonded via a ... the pantoate molecules insite I and site II of nPS. Oxygen atoms of pantoate and water are colored magenta and ochre, respectively. Direct protein–ligand hydrogenbonds are colored magenta, and...

Tài liệu Báo cáo khoa học: Minor capsid proteins of mouse polyomavirus are inducers of apoptosis when produced individually but are only moderate contributors to cell death during the late phase of viral infection ppt

... thatboth VP2 and VP3 kill cells comparably fast and efﬁ-ciently and are associated not only with a damagedER, but also with mitochondrial and other intracellu-lar membranes.The observed association ... caspase 3 activity and thecaspase inhibition assayAt indicated time-points, cell lysates were prepared and tested for cleavage of amino acid DEVD sequences by cas-pase 3 using the CaspACE assay ... donkey anti-mouse IgG conjugated with AlexaFluor 488 and goat anti-rat, goat anti-rabbit and donkeyanti-goat IgGs conjugated with Alexa Fluor 546 (all fromMolecular Probes). Goat anti-rabbit...

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACGR1_pLC1 TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACPEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAAR1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAACATH1_pUG36_D GCACTAGTATGAAAAGAATAAGATCGCTTTATH1_pUG36_R...

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deﬁciency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

... biochemical modulators and proin-flammatory factors contributing to systemic and peripheral vascular inflammation. These include inter-leukin (IL)-6, IL-1b, plasminogen activator inhibitor-1(PAI-1), ... conclusionsVisceral obesity, in particular, is characterized by increased inflammatory factors, decreased plasma TTlevels and endothelial dysfunction. Obesity is associ-ated with decreased TT, BAT and FT ... investigation. Although androgens are critical to normal erectile function, healthy lifestyle factorssuch as a reduction in caloric intake with a a concomi-tant increase in physical activity have...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf kết quả nghiêncứu các đề án vnrp tóm tắt báo cáo khoa học tập 3 tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị báo cáo khoa học tài chính công Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI