0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... 4183 Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations Mousumi Banerjee1, Hemalatha Balaram2 and ... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... with dra-matically reduced activity. The role of dimer interface residues in the stability and activity of the Plasmodium falciparum enzyme, PfTIM, hasbeen probed by analysis of mutational effects...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... exception that sonicationwas used instead of high pressure homogenization, the purification was conducted on an A ¨KTAxpress system(GE Healthcare).Crystallization, data collection and structuredeterminationCrystals ... phosphoribosyl-transferase activity [10]. The structural characterization of numerous com-plexes of the human HPRT and several bacterial and protozoan HPRTs have been undertaken [13–17]. The structure of ... nucleotidebeing added to crystallization solutions. The ligandbound was interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

... wavenumbervalues, indicating the loss of b-sheet and the onset of a- helix structure formation. To visualize the trend in the formation of b-sheet as a function of increasingSDS concentrations, the ratio ... betweenC-peptide and insulin, leading to an effect on the oli-gomer. The effect of NaCl and formamide on oligomerformation was also tested. NaCl breaks electrostaticinteractions, whereas formamide breaks ... a control, the signal intensity of acetate (at 2 p.p.m.) wasalso monitored as a function of the SDS content(Fig. 2A) and, as expected, no significant effect on the peak intensity is seen at...
  • 10
  • 561
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... 50 and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated k on and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity ... domain has fundamen-tal structural, thermodynamic and mechanistic featuresin common with the dual-flavin family of reductases,there are unique aspects related to NO synthesis thatconstrain and ... roles of CaM, the CT and bound NADPH have been studiedin detail. An interesting and possibly novel connectionappears to link regulation of Keq A by the CT and Table 1. Factors that may alter conformational...
  • 16
  • 639
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... MM & Kostic NM (1996) Effects of temperature on the kinetics of the gated electron-transfer reaction between zinc cytochrome c and plastocyanin. Analysis of configurational fluctuation of the ... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR withNADH. The wt trace is fit to a single exponential and the N18 9A trace to a 4-exponential function – see the main text ... substrate-binding titrations and crystallo-graphic studies when a very large amount of the sub-strate may be required; typical NAD(P)H saturationconstants for OYEs are 0.1-1 mm and as an example,a...
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... FX,F A and FB.FXis coordinatedby cysteines located in both of the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE arelocated ... in favour of a stronger H-bond between the carbonyl of N58 (‘O-up’ conformation) and FMNN(5)H [41]. The semiquinone states of A. nidulans and Anabaena Flds are less stable than those from otherspecies ... isretained and changes either the overall interaction or the electron transfer parameters. Recent analysis of multiple charge-reversal mutations on the Fld surfaceconcluded that interactions do...
  • 17
  • 634
  • 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... LapierreC & Dumont M (1993) Isolation and characterization of histogranin, a natural peptide with N-methyl-D-aspartate antagonist activity. Eur J Pharmacol MolPharmacol 245, 247–256.15 Lemaire ... oxidation DNP (A, B), the aconitase inhibitor fluoroacetate (C, D) and the inhibitor of DNA gyrase-linked ATPase,coumermycin A1 (E, F) on the bactericidal activity of H4-(86–100) and ciprofloxacinagainst ... neutralization of some external groups of the membrane, and then allowing the aliphatic orneutral groups of the peptide to attach to internalhydrophobic sites for rapid penetration and actioninside...
  • 12
  • 756
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... b-strands,six a- helices and three 310-helices. The core of the pro-tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella ... Studies haveshown that there is a functional relationship betweenSurE and Pcm. l-isoaspartate O-methyltransferaseconverts isoapartyl residues to l-aspartyl residues and thereby repairs damaged ... subunits related by crystallo-graphic twofolds form a tetramer very similar to that of the monoclinic form. The total surface-accessiblearea buried on dimerization of A and B subunits of the monoclinic...
  • 10
  • 553
  • 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... antagonism in the REF assay, subcellular localization, and transcrip-tional activity. Some of these analyses have assigneddifferential functions to the two isoforms, and we showthat the unique ... transcriptional repression and activationdomains, WT1s lacks the repression domain and, conse-quently, has different effects on downstream targets and in growth ⁄ cancer-related assays [26].Our Flag ... 2007 The Authors Journal compilation ª 2007 FEBSlocalization cannot provide a basis for the differentialeffect of the two isoforms on Myc-induced cellulartransformation. The evolutionarily conserved, ...
  • 11
  • 586
  • 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... and part of the His-tag was observed in the B chain. A fewamino acid residues are found in disallowed regions in the Ramachandran plot; these are A4 , A1 65, A1 67, B3, B4 and F165, all of which are ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP.In order to determine the true Kmfor UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ... binding the adenine base of anATP analogue (Protein Data Bank accession numberTable 1. Data collection and refinement statistics. Values in paren-theses refer to the data in the highest-resolution...
  • 12
  • 656
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM