Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... 2009 The Authors Journal compilation ª 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng Cai1, Peter Trodler2, Shimin Jiang1, ... high-activity D-hydantoinase from Jannaschia sp. CCS1 FEBS Journal 276 (2009) 3575–3588 ª 2009 The Authors Journal compilation ª 2009 FEBS 3579 characterization and evaluation of HYDJs from Jannaschia ... Metab Dispos 2,103–112.11 Moller A, Syldatk C, Schulze M & Wagner F (1988)Stereo- and substrate-speciﬁcity of a d-hydantoinase and a d-N-carbamyl amino acid amidohydrolase of Arthrobacter...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... sites using a forwardoligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence ... chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of  81 000 A ˚2with 30% ( 24 000 A ˚2) as con-tact area. ... Gly-Gly-Cyssequence was introduced at the C-terminus using oligomers5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21cells were transformed...

Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

... 5¢-AAGATGAAACGTGAGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAATAC-3¢ (CA2). The 3¢ region of the hazelnut LOX cDNAwas ampliﬁed using the following primers: 5¢-GTTTGGAAGAGAGATGCTGG-3¢ (CA3); 5¢-AAAGTTTTTAGATTGAGACACTATTGGGAATT-3¢ ... were obtained byPCR using hazelnut genomic DNA as template, theprimers 5¢-CTATGATTATGATGTCTACAATGATTTGGG-3¢ (ML1) and 5¢-GCAAATTCTTCATCAGTCATCCATGCAGAC-3¢ (ML2) and the following ampliﬁcationconditions: ... Nucleotide and deduced amino acidic sequences of thehazelnut LOX gene. The inverted repeats are in bold and their orientations are indicated by arrows. TATA and CAAT boxes and the initiatingATG are also...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... 6615–6627.24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthineguanine phosphoribosyltransferase expands substratespeciﬁcity. Arch Biochem Biophys ... side chain of Asp201, a phosphate ion and ﬁve water molecules.The phosphate involved in this interaction is bound bymain chain interactions with Lys76 and Gly77 and the side chain of Arg207....

Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

... product. Sense primer, 5¢-GAGAGAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeIsite; antisense primer, 5¢-GAGAGAAAGCTTCAAAACTGGGACAGTTG-3¢, HindIII site.The same method was used to amplify the codingsequence ... Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E,Nakamura Y, Miyajima N, Hirosawa M, Sugiura M,Sasamoto S et al. (1996) Sequence analysis of the gen-ome of the unicellular cyanobacterium Synechocystis ... forward primer1, 5¢-ATGGCGGCGATTACAGAATT-3¢, reverse primer1,5¢-TCAAGCAAGGATCAGAGTGA-3¢. The sequence wasobtained from the TIGR database (At1g65820 68408.m06848putative microsomal glutathione...

Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx

... chloroplastswere separated in CN ⁄ PAGE (1D, the hori-zontal bands) and then in nondenaturingconditions by BN ⁄ PAGE (2D). The molecular mass standards and direction of migrationare indicated ... Sazanov LA, Burrows PA & Nixon PJ (1998) The plastidndh genes code for an NADH-speciﬁc dehydrogenase: isolation of a complex I analogue from pea thylakoidmembranes. Proc Natl Acad Sci USA 95, ... suggest that the Ndh complex exists as a monomer and dimer and splits into a membrane and soluble subcomplexes.Separation of the Ndh complex by CN/PAGE(1D) and Tricine/PAGE (2D) and CN/PAGE...

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... Fernadez-Larrea, J. & Stahl, U. (1996) Isolation and character-ization of a laccase gene from Podospora anserina. Mol. Gen.Genet. 252, 539–551.36. Saloheimo, M., Niku-Paavola, M L. & ... Biochemical and molecular characteri-zation of the diphenol oxidase of Cryptococcus neoformans:iden-tiﬁcation as a laccase. J. Bacteriol. 176, 656–664.39. Zhao, J. & Kwan, H.S. (1999) Characterization, ... cycles of 94 °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a ﬁnal extension at 72 °Cfor 10 min. The primers for lac1 PLAC1F(5¢-AGCTTTCATTCCCAGTGATTG-3¢)andPLAC1R(5¢-AACGAGCTCAAGTACAAATGACT-3¢)...

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts3 and Ana Paula U. Arau´jo1,21 Programa de Po´s-graduac a o em Gene´tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil2 Instituto de Fı´sica de Sa˜o Carlos, Universidade ... displayed hemagglutination and toxicitytoward mice (data not shown), additional efforts tocleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing...

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation ... AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG...

Xem thêm

Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP