Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that ﬁnally ... respiratory chain, the assistance of speciﬁcchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1intermediate[28,29] ... were of analytical grade. Yeast strains and growth media The genotypes and sources of the S. cerevisiae strains aredescribed in Table 2. The ISP deletion strain wasprepared in accordance with the...

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... for the a domain are larger than those for the b domain.Further interpretation of these data resulted in the proposal of positively cooperative metal binding as the primary metallation mechanism ... domain of human MT- 1a [29] showed that the single remaining metal ion in the demetallationreaction was the C-terminal metal ion, indicating that occupancy of this metal site resulted in the least ... the a domain, has been construedas being an indicator of cooperative metal binding to the a domain. This study focuses on the metallation of the isolated a domain, with the purpose of clarifyingthis...

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... AlaP2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn3K ... ggcgtcatcggtggagggctttttggcaccaaaaag Val16, Val17 and Leu18 to GlyF2 0A F2 0A F catcgttgtactgcttgctggcaccaaaaagctc Phe20 to AlaG2 1A G2 1A F gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K24A...

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... forma-tion assay. Table 2 shows the percentage of G418-resistant colonies obtained by transfecting the establishedhuman tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma MDA-MB-231 ... functions as a molecular switch in a large network of signaling pathways [1]. Mutations in the ras gene havebeen identiﬁed in about 30% of all human cancers,indicating that this molecule is a preferential ... conﬁrmed the accumulation of the single-chain aD11-sec as a ladder of higher-electrophoretic-mobility bands (lane 9). Together these results indicate that the single-chain aD11-sec was ubiquitinated...

Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

... autophosphorylating ability o f PknAis strictly magnesium/manganese-dependent, and sodiumorthovanadate can inhibit this activity. Phosphoamino-acidanalysis ind icated that PknA phosphorylates at serine andthreonine ... lunt-endedfragment was cloned at the SmaI site of pUC19 (pPknA).Plasmid DNA was prepared after transform ation of pPknA in E. coli strain DH 5a and sequenced in an automatedsequencer (ABI; PE Applied ... wereprocessed in the same way as pMAL-PknA except that IPTG induction was not required.Kinase assay The ability of PknA or the K42N mutant, as a puriﬁedfusion protein with MBP, to autophosphorylate andphosphorylate...

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... coenzyme analog lacking the ade-nine ring in the upper axial ligand; a model of damagedcofactors) for free adeninylpentylcobalamin (AdePeCbl)(an inactive coenzyme analog containing the adeninering ... 11 A ˚ in height. The size of this cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damagedcofactor to pass through it. Intact cofactor, an ade-nine-containing ... Considering that the enzyme contains two cobal-amin-binding sites in the (abc)2dimer, it can beassumed that the reactivase mediates the exchange of enzyme-bound damaged cofactor for intact AdoCblwith...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealingbecause of the presence of a putative nucleotide-bind-ing motif in the N-terminal of the protein sequenceand ... encodes a ( 42 kDa) protein that has anN-terminal signal sequence suggestive of a location in the periplasm. On the other hand, in Ps. aeruginosa(PAO1), NirF has no apparent signal sequence andtherefore ... issuggestive of a binding to a nucleotide-containingcofactor. This motif has also been found in severalother dehydrogenases involved in tetrapyrrole biosyn-thesis pathways, including CysG A and SirC in...

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... defective at cleaving a substrateinvolved in the activation of the Nlrp1b in ammasome.AbbreviationsERK, extracellular signal-related kinase; HA, hemagglutinin; IL, interleukin; JNK, c-Jun N-terminal ... of amino acids that has previouslybeen implicated in binding MAPKKs [22]. Glu682 iswithin an a- helix that also contains the amino acids A BFig. 1. An LF double mutant, LF-K518E ⁄ E682G. (A) ... wasconsiderably more defective in cleaving MAPKK6. The inability of the mutant to prevent phosphorylation of p38 (Fig. 3) indicated that the level of MAPPK3 ⁄ 6 that remained in the cell was...

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HAPs can initi-ate hydrolysis of phytate at either the C3(EC ... smaller than for AppA, showing that binding is favored by the preformed site. By con-trast, catalysis by AppA is faster, as reﬂected in the values for kcat⁄ Km, indicating that a conformationallyﬂexible ... December2009)doi:10.1111/j.1742-4658.2010.07559.x The extracellular phytase of the plant-associated Klebsiella sp. ASR1 is a member of the histidine-acid-phosphatase family and acts primarily as a scavenger of phosphate groups locked in the...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. The primers were designed to introduce ... EXAFS analysis that the Fe2+cofactor is coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conﬂict of this ﬁnding ... in a total volume of 600 lL,which contained 10 lL of enzyme, appropriately diluted tomeasure the initial rate. The enzymatic rate was obtainedfrom the linear plot of substrate converted against...

Xem thêm