Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... chain A is close to Ala25 of chain B.Chain A Chain B Hydrogen bondsAla25 Asn77, Arg80 AlaO–ArgNH1AlaO–ArgND2Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1AsnOD1–HisNE2Ser28 Arg76Trp30 Arg42, ... of acidic stress response factor HP1286 FEBS Journal 277 (2010) 1896–1905 ª 2010 The Authors Journal compilation ª 2010 FEBS 1905 Helicobacter pylori acidic stress response factor HP1286 is a YceI ... expression, and puriﬁcationThe HP1286 gene was ampliﬁed by PCR from H. pylori CCUG17874 genomic DNA using the following primers:forward, 5¢-CACCAAACCTTATACGATTGATAAGGCAAAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCTTCTAG-3¢....

Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural speciﬁcity variants doc

... when assayed with non-radioactive cana-vanine using the [32P]-labelled tRNA assay [28]. For thejack bean enzyme, a distinct discrimination betweenarginine and canavanine for aminoacylation ... methodAminoacylation of transcript tRNA with [14C]-labelled amino acidAminoacylation of [32P]-labelled transcripttRNADiscrimination factor( kcat⁄ KM)Arg⁄ (kcat⁄ KM)CavArg Cav Arg ... preparations of arginyl-tRNAsynthetases that retained a 3.2 kDa N-terminal exten-sion compared to the native enzyme.Sequence analysis of the tRNAArgACGgene fromCanavalia ensiformis established...

Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm ﬁbers to single nucleosomes pdf

... assembly and remodel-ing factor (ACF) assembled chromatin and (d) chro-matin assembled in nuclear extracts. These distinctsubstrates have different properties and advanta-ges ⁄ disadvantages ... lmÆs)1revealed a sawtoothproﬁle, which started to appear at forces above 20 pNand continued until about 40 pN. The analysisrevealed three distinct characteristic DNA releaselengths: 65, 130 and ... ionicstrength) a signiﬁcant increase in the number of 50-nmevents was observed. This was interpreted as an effectof histone octamer stabilization and the release of allthe DNA associated with a histone...

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) andRGG1 ... primers: KGG3-2 forwardd(AAA GGT GGC AAA GGT GGA GAC AGA GGTGGC TT) and KGG3-2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers: ... compilation ª 2011 FEBSIdentiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA -binding proteinKentaro Takahama1,*, Katsuhito Kino2,*, Shigeki Arai3, Riki Kurokawa3and Takanori...

Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc

... The targetmRNA was normalized against actin in the same sample.The PCR primers were as follows: actin forward, 5¢-GAAATCGTGCGTGACATCAAAG-3¢; actin reverse, 5¢-TGTAGTTTCATGGA TGCCACAG-3¢; Akt-1 ... 693TTTTTCAGTGCAGAA-3¢; aP2 forward, 5¢-AAAGACAGCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGACCAAATCCCCATTTACGC-3¢. Standard curves were gen-erated with 10-fold serial dilutions ranging from ... antibody against caspase-8 were from BDPharmingen (San Jose, CA, USA). Antibodies against Badand phosphorylated Bad (pBad) (Ser136) were from AssayDesigns (Ann Arbor, MI, USA). Antibody against...

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 5′3′UAAAUGUGAAUACAAUGUGAAA GCUAAGAGUUAIL6R ... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA ... (A) and colonyformation (B) assays (*P < 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a ...

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... leaﬂets. We thus conclude fromthese data that Ab interacts with the membrane in a Table 4. Average values of deuterium order parameters. Data are the mean (± SD).SimulationTop leaﬂet plateau ... membrane-perturbing Ab40 peptide.Although it is known that Ab can interact with theplasma membrane and assemble in this environment[6], a fundamental understanding of the molecularbasis for ... observations made from our simulations com-pare well with experimental observations. An earlystudy by Mason et al. [7] indicated that Ab40 wascapable of penetrating into rat synaptic plasma mem-branes,...

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... -ATC ATC TCCATC GAC TAC TCC CTG-3¢, the antisense primer5¢-AAG AATTCT AGA TTA ATG GTG ATG ATG GTGATG ATG GTG TGG GGT CAG CGG TGC AGC AGGGGG GGT-3¢ (XbaI sites underlined; His-tag in italic) ... notnecessary, probably because of a lower degree ofinteraction of ATP with SYPRO Orange than with bis-ANS. The molar concentration of SYPRO Orange is impossible to calculate, as the molecular mass is ... accelerating voltage (Jeol, Tokyo, Japan). Imageswere recorded with a Gatan Multiscan 791 CCD camera(Gatan UK, Abingdon, UK) [23].AcknowledgementsWe would like to thank B. Danielsson and M. Baum-garten...

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

... Blake T, Mishra L & Mishra B(2008) TGF-beta signaling in neuronal stem cells. DisMarkers 24, 251–255.36 Dohgu S, Yamauchi A, Takata F, Naito M, Tsuruo T,Higuchi S, Sawada Y & Kataoka ... Tomita S, Ueno M, Sakamoto M, Kitahama Y,Ueki M, Maekawa N, Sakamoto H, Gassmann M,Kageyama R, Ueda Net al. (2003) Defective braindevelopment in mice lacking the HIF-1alpha gene inneural cells. ... growth factor control ofneuronal expression of angiogenetic and vasoactivefactors. Proc Natl Acad Sci USA 98, 4160–4165.51 Hansen-Algenstaedt N, Algenstaedt P, Schaefer C,Hamann A, Wolfram L,...

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... WASP) -binding domain and a novelC-terminal actin -binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. Vajjhala4and Alan L. Munn1,3,4,6*1 ... vrp1D::KanMx bar1)[23], IDY166 (MATa his3 leu2 ura3 trp1 las17D::URA3 )[20], and PJ69- 4A (MATa his3 leu2 ura3 trp1 gal4D gal80Dmet2::GAL7-lacZ GAL2-ADE2 LYS2::GAL1–HIS3) [64].Yeast strain PJ69- 4A ... polyclonal GFP-spe-ciﬁc antiserum was a gift from J. Kahana and P. Silver(Dana Farber Cancer Center, Boston, MA). The anti-actinmAb was MAB1501 from Chemicon International (Teme-cula, CA). The anti-hexokinase...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vv báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien tai lieu bao cao thuc tap y si da khoa báo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptx tai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinh báo cáo khoa học về nghệ thuật trong lieu trai chi di tai lieu bao cao thuc tap tai khoa duoc benh vien hop luc đề tài báo cáo khoa học Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP