Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... haemagglutinin; HAI -1, hepatocyte growth factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth factor activator; ... Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yoko...

Ngày tải lên : 15/02/2014, 01:20

13
641
0

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

... double stranded oligos Oct -1, 5¢-TGT CGAATGCAAATCACTAGAA-3¢; Sp1, 5¢-ATTCGATC GGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAG CAGGAAGTTCGA-3¢; Ets (PU .1) , 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; ... from a pM166 template using a common sense primer 5¢-GAATAAGGAGGGCAGGGTGAA-3¢ (posi- tions )13 20 to )13 02 in GenBank accession no. AF025 817 ), and the antisen...

Ngày tải lên : 20/02/2014, 11:20

13
525
0

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep 24, 10 73 11 09. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (19 85) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... angiotensin-converting enzyme, produced by actinomycetes. J Antibiot (Tokyo) 38, 18 13 18 15. 33 Aoyagi T, Wada T, Iinuma H, Ogawa K, Kojima F, Nagai M, Kuroda H,...

Ngày tải lên : 16/02/2014, 09:20

14
614
0

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mikko Nikinmaa 1 1 Centre ... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTG...

Ngày tải lên : 18/02/2014, 14:20

9
457
0

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... 15 Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... c release, mitochondrial membrane depolarization, caspase-3 activation, and Bax -a cleavage during IFN -a- induced apoptosis in Daudi B lymphoma cells. J Interferon Cytokine Res 20 , 11...

Ngày tải lên : 19/02/2014, 06:20

11
679
0

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... template. PDE1(Arg189–Thr620) was ampliﬁed using the primer pairs 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys3 21 Thr620) was ampliﬁed ... 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. The resulting DNA fragments (1. 29 and 0.90 kbp) were digested with NdeI a...

Ngày tải lên : 19/02/2014, 12:20

11
566
0

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam)...

Ngày tải lên : 19/02/2014, 12:20

10
500
0

Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

... chromatogram, peaks in the original region (fractions 11 15 ; Fig. 3A) disappeared and new peaks (fraction 12 , 15 and 18 ; Fig. 3B) were detected indicating that the amyloglucosidase treatment was effective. ... a- amylase treatment were separated by RP-HPLC (SMART system, Pharmacia, Uppsala, Sweden) on a Pharmacia C2/C18 SC 2 .1/ 10 column using a linear 0–50% (v/v) acetonitr...

Ngày tải lên : 19/02/2014, 16:20

12
513
0

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... Computational Linguistics, pages 12 10 12 19, Portland, Oregon, June 19 -24, 2 011 . c 2 011 Association for Computational Linguistics Creating a manually error-tagged and shallow-parsed learner corpus Ryo ... North American Chapter of the ACL, pages 15 4 16 2. Joel Tetreault, Elena Filatova, and Martin Chodorow. 2 01 0a. Rethinking grammatical error annotation and evaluation wit...

Ngày tải lên : 20/02/2014, 04:20

10
467
0

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... ACL-HLT 2 011 System Demonstrations, pages 32–37, Portland, Oregon, USA, 21 June 2 011 . c 2 011 Association for Computational Linguistics MemeTube: A Sentiment-based Audiovisual System for Analyzing ... emoticons. This is similar to what many people have proposed for evaluation (Davidov et al. 2 010 ; Sun et al. 2 010 ; Bifet and Frank 2 010 ; Go et al. 2009; Pak and Paroubek 2...

Ngày tải lên : 20/02/2014, 05:20

6
449
0