Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... 2010 The Authors Journal compilation ª 2010 FEBS Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl ... & Auling G (1998) Clon-ing and sequencing of the nrdF gene of Corynebacterium ammoniagenes ATCC 6872 encoding the functionalmetallo-cofactor of the manganese -ribonucleotide reductase (Mn-RRase). ... chemistry involv-ing an array of diverse metallocofactors. The nucleotide reduction gene (nrdF) encoding the metallocofactor containing small subunit (R2F) of the Corynebacterium ammoniagenes ribonucleotide...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx
... molecular basis for new therapeutic strate-gies targeting specific pathways to treat human heartdisease.Materials and methodsAnimalsNeonatal Wistar rats (1-3 days) were purchased from the Animal ... kDanucleolin ⁄ C23 fragment accompanied by the appear-ance and an increase in the 80 kDa fragment (Fig. 2).Although both the untransfected cells and the cellstransfected with the vector alone started ... accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All efforts were made to minimize the number of animals used and their suffering.H2O2pcDNA3.1100100...
- 11
- 614
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... Ca2+-dependentmanner almost as effectively as intact Akazara scallop troponin. Therefore,Akazara scallop troponin regulates the contraction through the activatingmechanisms that involve the region spanning ... of both TnC and Ca2+; lanes b and e, in the presence of TnC and the absence of Ca2+; lanes c and f, in the presence of bothTnC and Ca2+. Ac, actin; Tm, tropomyosin; RTnC, rabbit TnC; ATnC, ... that the regulatory and Fig. 6. Ca2+-regulation of actomyosin-tropo-myosin Mg-ATPase by rabbit (A and C) and Akazara scallop (B and D) reconstituted tropo-nins. The effects of the troponin...
- 12
- 514
- 0
Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf
... fourtypes of features using the event of “Abdul HalimKhaddam resigns as Vice President of Syria” and the sentence The resignation of Khaddam was abrupt”as an example. In particular, the “depth” features ... de-noting the index of the word that is the descendant in dx and dx .a denoting the ancestor. We define the following matching function to match the pair of de-scendants (or ancestors):matchd(de, ... baseline, we trained and tested a model usingonly the lexical-matching features. We then trained and tested models using only the low-level features and all features. Figure 3 shows the performancestatistics...
- 4
- 392
- 0
Tài liệu Báo cáo khoa học: Dimer asymmetry and the catalytic cycle of alkaline phosphatase from Escherichia coli doc
... change in path C, and enabling a conformational change in path A, therebyincreasing the rate of both cycles. In reaction path A, binding of Mg2+to subunit 2 induces a conformational change from ... Dimer asymmetry and the catalytic cycle of alkaline phosphatasefromEscherichia coliStjepan Orhanovic´ and Maja Pavela-VrancˇicˇDepartment of Chemistry, Faculty of Natural Sciences, Mathematics ... ligand can be an amino acidside-chain from the active site region, leading to homo-dimer asymmetry. It has been established that Ser102, the amino acid acting as a primary nucleophile in the activesite...
- 9
- 590
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx
... a DNA-binding domain, a ligand-bindingdomain and a transactivation domain. The DNA-bind-ing domain is responsible for DNA binding specificity and dimerization, and the ligand-binding domain isresponsible ... eukaryotes indicate thatthey have crucial and distinct roles in gene activation and other cellular events. Although the discovery of MLLs and characterization of their HMT activities and protein–protein ... isresponsible for binding of the ligand and associatedinduced functions. The N-terminal region of NRs con-tains one highly variable transactivation region (AF1) and the C-terminal region contains a conserved...
- 15
- 607
- 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt
... qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78,AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C (C) are presented ... biological repli-cates were analyzed, and Fig. 2 depicts the profilematching both replicates.An increase in transcript abundance for AaEcRA,AaEcRB, AaE7 5A, AaE75B, AaE75C, AaHR3,AaHR4, AaE78 and ... non-20E-responsive genes AaERR (D), AaTll, AaPNR-like (E), AaSvp, AaHR38 (F) and the housekeeping genes AaS7 (E) and AaActin (F)are expressed as relative mRNA and are the mean of three independent biological...
- 22
- 578
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan ... kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its ... ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. 3. ACMSD I and ACMSD II extracellular expression. ...
- 14
- 601
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... outer reverse ACGAAACCTGGCAGAGTCCAAG B6R5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R7 both forward CAGAAAAAGACAAGGAGGAC F19RIsoform-specific ... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R)10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R)Real time PCR...
- 11
- 662
- 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... 5¢-GGGCACTCAGCCAGGGGACATCCTGCCCAA-3¢ as forward and 5¢-GATACAAGTTTGCACACCTTTGCACTTCTG-3¢ asreverse [58]. The PCR amplification was performed in a total volume of 50 lL reaction mix containing 1 ... concentration and qual-ity, the GAPDH gene was also amplified by using a similarprotocol with the housekeeping gene specific primers:5¢-CCATGGAGAAGGCTGGGG-3¢ as forward and 5¢-CAAAGTTGTCATGGATGACC-3¢ ... in the inner face of the plasmamembrane and that is translocated into the outer faceunder certain cellular states. Double-labeling withAnnexin V and CD1d revealed that a large number of HepG2...
- 14
- 682
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ