0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

... (IMMONC), Ricerca SanitariaFinalizzata, Ricerca Sanitaria Applicata; RibovaxBiotechnologies (Geneva, Switzerland) and FondazioneItaliana Ricerca sul Cancro (FIRC).References1 Pancholi V (2001) ... G,Giallongo A, Milella M et al. (2009) An integratedhumoral and cellular response is elicited in pancreaticcancer by alpha-enolase, a novel pancreatic ductaladenocarcinoma-associated antigen. ... [107–115].Acetylation, methylation and phosphorylation arethe main PTMs (Table 2). Acetylation was found incervix and colon cancer, leukemia, normal pancreaticducts and tumoral pancreatic cells....
  • 11
  • 721
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Updating a Name Tagger Using Contemporary Unlabeled Data" ppt

... name tagger based on co-training de-cays as the time gap between training data (seeds and unlabeled data) and test data increases (Mota and Grishman, 2008). Compared to the originalclassifier ... and has been extensively studied inNLP (Nigam and Ghani, 2000; Pierce and Cardie,2001; Ng and Cardie, 2003; Mota and Grishman,2008). In particular, we showed that the perfor-mance of a name ... theunlabeled data backwards. The choice of fixingthe test within the last epoch of the interval is theone that most approximates a real situation whereone has a tagger trained with old data and...
  • 4
  • 329
  • 0
Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt

Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt

... inhibitor;HSA, human salivary a- amylase; LCAI, Lachrima jobi chitinase/ a- amylase inhibitor; PAI, pigeonpea a- amylase inhibitor; PPA, por-cine pancreatic a- amylase; RASI, rice a- amylase/subtilisin ... Brazil, Fax: + 5 5 6 1 340 3624,Tel.: + 55 61 448 4705, E-m ail: ocfranco@cenargen.embrapa.brAbbreviations: AAI, Amaranthus a- amylase inhibitor; a- AI1 and a- AI2, a- amylase inhibitors 1 and 2 from ... bean; AMY1 and AMY2, a- amylases from barley seeds; BASI, barley a- amylasesubtilisin inhibitor; BLA, Bacillus licheniformis a- amylase; CAI,cowpea a- amylase inhibitor; CHFI, corn Hageman factor...
  • 16
  • 539
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... genomedatabanks. Interestingly, this domain was found insome closely related bacterial species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... function in activity, substrate binding and structural dynamics.Materials and methodsExperimental dataThe presence of a C-terminal putative binding domain invarious animal cell extracts was checked ... Sequence data were depos-ited in GenBank (Table S1).Searches in databasesUsing the putative C-terminal domain of C. fluminea as a query, sequence databases were searched by blastp and tblastn for...
  • 8
  • 624
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ forTMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-specific...
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1,Giovanna Tosi3, Leonardo Lopiano4 and Mauro Fasano11 Department of Structural and Functional Biology, and Centre of ... Journal compilation ª 2010 FEBS 4919Proteomic analysis of dopamine and a- synuclein interplayin a cellular model of Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, ... substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronaldeath is accompanied by the appearance of Lewybodies (LB), intracytoplasmic inclusions immunoreac-tive...
  • 11
  • 775
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... initiation- and cyclorelease-mechanisms.Abbreviations A, adenylation domain; ac-haOrn, a- N-acetly-d-N-acetyl-d-N-hydroxyornithine; C, condensation domain; CAS, chromazurol S;DKP, diketopiperazine;...
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... factor.Thus, TransLISA can replace EMSAs and may be used in various applica-tions and research fields where quantitative, cost-effective and large-scalemeasurements of the DNA-binding activity of transcription ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2 and Mikko Nikinmaa11 Centre...
  • 9
  • 457
  • 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... WASP)-binding domain and a novelC-terminal actin-binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. Vajjhala4 and Alan L. Munn1,3,4,6*1 ... polyclonal GFP-spe-cific antiserum was a gift from J. Kahana and P. Silver(Dana Farber Cancer Center, Boston, MA). The anti-actinmAb was MAB1501 from Chemicon International (Teme-cula, CA). The anti-hexokinase ... hand, and in corticalactin-patch polarization, on the other hand, are at leastpartially distinct [23]. However, there may still be a functional link between endocytosis and actin-patchpolarization....
  • 23
  • 679
  • 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... 40760–40767.34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S(1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting inapoptosis in BJAB cells. ... combination of IFNa and TRAIL,relative to TRAIL alone.In view of the cleavage of caspase substrates such asBID and PARP, the effect of IFNa and TRAIL onthe DNA content of MCF-7 cells was also assessed,using...
  • 11
  • 679
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo thường niên công ty cổ phần kỹ nghệ đô thành pptxtài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM