Tài liệu Báo cáo khoa học: How to remain nonfolded and pliab

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... How to remain nonfolded and pliable: the linkers in modular a- amylases as a case study Georges Feller 1 , Dominique Dehareng 1 and Jean-Luc Da Lage 2 1 Center for Protein Engineering, University ... bond hydrolyzed has the theoretical capacity to disrupt a hydrophobic interaction in the linker, inducing or favoring its extension. As the catalyti...

Ngày tải lên : 14/02/2014, 18:20

8
624
0

Tài liệu Báo cáo khoa học: "HOW TO MISREAD A DICTIONARY" pot

Ngày tải lên : 21/02/2014, 20:20

1
374
0

Tài liệu Báo cáo khoa học: "Learning to Find Translations and Transliterations on the Web" doc

... snippets, and generate features for each tokens in the same way as done in the training phase. We then use the trained model to tag the snippets, and extract translation candidates by identifying ... requiring minimal human intervention to prepare the training data. 3 Method To find translations for a given term on the Web, a promising approach is automati...

Ngày tải lên : 19/02/2014, 19:20

5
531
1

Tài liệu Báo cáo khoa học: Globin gene family evolution and functional diversiﬁcation in annelids ppt

... mutabilis NassaMb P31331 Scapharca inaequivalvis ScaHb1 Q26505 Anadara trapezia HBIaAna P14395 HBIIAna P14394 Barbatia lima BarbHBD Q17157 Biomphalaria glabrata HBD2Biom and HBD3Biom Q683R3 Artemia ... 489 CAG gt aaag ctaac ttgc ag GT Al. pompejana Hb Intron 1 B12.2 135 GGA gt aagt ctaac accc ag GT Intra Intron 2 G7.0 241 GCT gt aagt ctaac tttc ag GA Ar. marina Mb Intron 1 B12.2 301 CTT gt...

Ngày tải lên : 19/02/2014, 02:20

12
594
0

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... To amplify the DNA frag- ments containing a complete x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based ... frozen leaves by the Isoplant DNA extraction Kit (Takara Bio Inc., Shiga, Japan). PCR was performed using KOD DNA polym- erase (Toyobo, Osaka, Japan) and DNA AMPLIFIER MIR-D40 (Sanyo...

Ngày tải lên : 20/02/2014, 01:20

8
484
0

Tài liệu Báo cáo khoa học: How disorder inﬂuences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... an N-terminal hexahistidine tag was obtained by PCR using the pET2 1a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to ... hexahistidine tag fused to its N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-...

Ngày tải lên : 18/02/2014, 04:20

14
672
0

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... to the N-terminal protease domain, the carboxy-terminal domain of NS3 consists of an RNA helicase and NTPase activity. NS 4A serves as a cofactor for NS3. The functions of NS4B and NS 5A are largely ... of clinical HCV isolates is not as clear. Antibodies against CD81 or recombinant CD81 had no or only a marginal effect on the binding and internalization (as measure...

Ngày tải lên : 19/02/2014, 06:20

15
570
0

Tài liệu Báo cáo khoa học: Strategies to cover microbial proteomes ppt

... spatial and temporal resolution for imaging neocortical functions in the liv- ing brain, and has paved the way for a new era in the functional imaging of cortical dynamics. It has facilitated the ... vaccine candidate was successful as vaccine in animal models and is now in a clinical study. A proteome 2-DE database was established (http://www.mpiib-berlin.mpg.d...

Ngày tải lên : 19/02/2014, 07:20

7
468
0

Tài liệu Báo cáo khoa học: An engineered disulﬁde bridge mimics the effect of calcium to protect neutral protease against local unfolding docx

... calculated from the intensity of the protein band. Autoproteolysis in sample solutions containing <20 lgÆmL )1 protein was followed by determining the residual activity towards casein or the ... 300– 319 amino acid residues and are organized into two domains. They have one catalytic zinc ion, and between two and four stabilizing calcium ions. The X-ray structures of therm...

Ngày tải lên : 19/02/2014, 17:20

12
610
0

Tài liệu Báo cáo khoa học: "Learning to Translate with Multiple Objectives" doc

... vector w, takes in a foreign sen- tence f and returns a translated hypothesis h. The argmax operates in vector space and our goal is to ﬁnd w leading to hypotheses on the Pareto Frontier. In the ... dominating point. ilar to many MT optimization methods. The main difference is that rather than trying to maximize a single metric, we maximize the number of pare...

Ngày tải lên : 19/02/2014, 19:20

10
624
0