Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... is an alternative isomerase in the retina of cone-dominant species, likely in retinal Mu¨ller cells [33,34]. In the present study, we report the clon ing and characterization of a novel isomerohydrolase ... subcellular fractionationTo analyze the cellular localization of zebrafishRPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specificity of the antibody was...

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... protein kinase 1 (DAPK-1) is a Ca2+⁄ calmodulin-regulated serine ⁄ threonine kinasecomposed of multiple functional domains, including a kinase domain, a calmodulin-binding domain, eightankyrin ... occur in human cancers.To begin functional studies of s-DAPK-1, the s-DAPK-1 cDNA was cloned into a Flag–Myc vector(Fig. 2A) , which contains an N-terminal Flag tag and a C-terminal Myc tag, and ... integrin-mediated polarity pathway.J Cell Biol 172, 619–631.10 Inbal B, Bialik S, Sabanay I, Shani G & Kimchi A (2002) DAP kinase and DRP-1 mediate membraneblebbing and the formation of...

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... only lacks the conserved Na+binding sitebut also the essential negative charge (glutamate oraspartate) in transmembrane helix four as part of the ion-binding site. Therefore, the c ring of A. ... hasonly 10 membrane-buried negative charges that areessential for binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that ... ion ﬂow across the membrane[4–6].Subunit c of the F1F0ATP synthases has a molecularmass of approximately 8 kDa, and folds in the mem-brane like a hairpin, with two transmembrane helicesconnected...

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... membrane, most of these mitochondrial pro-teins behave as if they have a- helical transmembrane domains, rather thanb-barrels. These proteins are usually predicted to have a single a- helicaltransmembrane ... phase separation to be the most reliablemeans of purifying integral membrane proteins from the mitochondrial outer membrane, and of the 11 mostabundant integral proteins, 10 had a- helical transmem-brane ... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteinsare assembled in the bacterial outer membrane in a process mediated...

Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx

... substrings of stacks, and the symbol X to range over elements from A4 . A configuration (A, w) of the automaton con- sists of a stack A • $ and a remaining input w. The steps of the automaton are ... correctly. The language de- scribed by the grammar contains exactly the strings abc, a& apos;b'c ~, adbec, and a& apos;db'ecq The algorithm from Schabes and Vijay-Shanker (1990) however also ... as the set of auxiliary trees that can be adjoined at N. This set may contain the element nil to indicate that adjunction at that node is not obligatory. An example of a TAG is given in...

Tài liệu Báo cáo khoa học: "An Alternative Conception of Tree-Adjoining Derivation*" ppt

... taken full advantage of this decoupling, and are not as appro- priate as they might be for the kind of further analysis that tree-adjoining analyses could make possible. In particular, the ... seen in that any adjunetion of/ 32 at a node at which an adjunction of/ 31 occurs could instead be replaced by an adjunction of/ 32 at the root of/ 31. The advantage of this standard definition of ... recognition and parsing. 1 Introduction In a context-free grammar, the derivation of a string in the rewriting sense can be captured in a single canonical tree structure that abstracts all possible...

Tài liệu Báo cáo khoa học: "An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation" docx

... LinguisticsNiuTrans: An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation Tong Xiao†‡, Jingbo Zhu†‡, Hao Zhang† and Qiang Li† †Natural Language Processing Lab, Northeastern ... phrase-based and syntax-based machine translation. The toolkit supports several state -of -the- art models developed in statistical machine translation, including the phrase-based model, the ... proposed in (Chiang, 2007) and estimate the associated feature values as in the phrase-based system. For the syntax-based models, all non-terminals in translation rules are annotated with syntactic...

Tài liệu Báo cáo khoa học: "An API for Measuring the Relatedness of Words in Wikipedia" docx

... seman-tic relatedness of words in Wikipedia.1 Introduction The last years have seen a large amount of work in Natural Language Processing (NLP) using measures of semantic similarity and relatedness. ... Italian Wikipedias and can be eas-ily extended to other languages4.4 Software ArchitectureWikipedia is freely available for download, and canbe accessed using robust Open Source applications,e.g. ... Java and the Perl routines.5. Java wrapper library: provides a simple inter-face to create and access the encyclopedia pageobjects and compute the relatedness scores. The information ﬂow of...

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... T-cell kinase (ITK) could in uence the infectivity of HIVand also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining ... directly involved in ligandbinding, presumably abolishing the interaction withsignaling partners. The remaining mutations alteramino acids located outside the ligand-binding pocketand reduce ... 287–299.27 Plebani A, Soresina A, Rondelli R, Amato GM, AzzariC, Cardinale F, Cazzola G, Consolini R, De Mattia D,Dell’Erba G et al. (2002) Clinical, immunological, andmolecular analysis in a large...

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... 3B). Again, these changes were abol-ished in female db ⁄ db heart mitochondria. Together,these data suggest that the greater reliance of femalemurine cardiac mitochondria on glucose than on fattyacids ... (decrease in fatty acid utilization,increase in glucose utilization) in the murine femaleheart. Moreover, our data suggest that these changesoccur in an Akt-independent manner. Further studiesare ... mitochondrial fattyacid-transferring enzyme; MCAD, a representative fattyacid b-oxidation enzyme; PPARa, a key transcriptionalregulator of fatty acid genes; UCP3; the cardiac-enrichedGLUT4; and...

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ