Tài liệu Báo cáo " English - A global language and its implications for students " ppt

Tài liệu Báo cáo " English - A global language and its implications for students " ppt

Tài liệu Báo cáo " English - A global language and its implications for students " ppt

... explanations about how a language achieves a global status”. Some believe that easy grammar structures, familiarity in vocabulary, and the rich in culture. etc. make a global language and ... also claims that there are two main ways to make it possible to make a language global language . The first way is official way, that is, a language can be chosen to be...
Ngày tải lên : 12/02/2014, 20:20
  • 7
  • 771
  • 5
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

... work. The first type of data, called A- data, is a travel infor- mation data set harvested from the databases avail- able on the web, e.g., Wikipedia and Google Map. A- data consists of 1, 603 sentences ... of data, called Q-data, is the edited transcription of a speech data set simulating human-computer dialogues in a lab environment. Q- data is intended for the system to learn to...
Ngày tải lên : 20/02/2014, 05:20
  • 6
  • 555
  • 0
Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

... for any sor~ of natural language like interface. To the contrary, we have indirect empirical data that supports the premise that a natural language llke interface would be a disadvantage. For ... sure that given such a powerful capability, what a group of users would end up with would be very far from a natural language. The argument is sometimes made that a natural...
Ngày tải lên : 21/02/2014, 20:20
  • 2
  • 465
  • 0
Tài liệu Báo cáo khoa học: "Combining Functionality and Object Orientedness for Natural Language Processing" ppt

Tài liệu Báo cáo khoa học: "Combining Functionality and Object Orientedness for Natural Language Processing" ppt

... for manipulating data. Objects can be classified into classes and instances. A class defines a procedure [called a method) for handling incoming messages of its instances. A class inherits ... 'ease' and whose value is 'subject '. ; a variable rrteasage holds the value of an incoming message and a variable self points to the oSjeet itself. clas...
Ngày tải lên : 21/02/2014, 20:20
  • 4
  • 422
  • 0
Tài liệu Báo cáo khoa học: "Word Vectors and Two Kinds of Similarity" pptx

Tài liệu Báo cáo khoa học: "Word Vectors and Two Kinds of Similarity" pptx

... technique for automatic in- formation retrieval (Deerwester et al., 1990), but several studies (Landauer and Dumais, 1997) have shown that LSA successfully mimics many hu- man behaviors associated ... comparison among four combinations of corpora and text units for the LSA-based and the cooccurrence-based 861 Table 1: Comparison of mean correct rate among the combinations of two cor...
Ngày tải lên : 20/02/2014, 12:20
  • 8
  • 473
  • 0
Tài liệu Báo cáo khoa học: "Fast Decoding and Optimal Decoding for Machine Translation" doc

Tài liệu Báo cáo khoa học: "Fast Decoding and Optimal Decoding for Machine Translation" doc

... California Stanford University 4676 Admiralty Way, Suite 1001 Stanford, CA 94305 Marina del Rey, CA 90292 jahr@cs.stanford.edu germann,knight,marcu,kyamada @isi.edu Abstract A good decoding algorithm ... pa- per, we compare the speed and out- put quality of a traditional stack-based decoding algorithm with two new de- coders: a fast greedy decoder and a slow but optimal decoder th...
Ngày tải lên : 20/02/2014, 18:20
  • 8
  • 440
  • 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

... Ishida S, Inoue A, Kan Y & Yasumoto T (1995) Palytoxin analogs from the dino- flagellate Ostreopsis siamensis. J Am Chem Soc 117, 5389–5390. 5 Taniyama S, Arakawa O, Terada M, Nishio S, Takatani ... MINIREVIEW Marine toxins and the cytoskeleton: a new view of palytoxin toxicity M. Carmen Louzao, Isabel R. Ares and Eva Cagide Departamento de Farmacologia, Facultad de Veterinaria, Uni...
Ngày tải lên : 18/02/2014, 14:20
  • 8
  • 691
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Natl Acad Sci USA 102, 4235–4239. 33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase ... M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but not syn- thet...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan ... Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identifica- tion and expression of a cDNA encoding human a- amino-b-carboxymuconate-...
Ngày tải lên : 19/02/2014, 02:20
  • 14
  • 601
  • 0
Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx

Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx

... Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl Nidhi Shukla 1 , Anant Narayan Bhatt 1 , Alessandro ... FprA and the 0.8 m CaCl 2 -stabilized apo-protein and analysed it by monit- oring the changes in tryptophan fluorescence as sum- marized in Fig. 4A. For 0.8 m CaCl 2 -stabilized FprA, a...
Ngày tải lên : 19/02/2014, 16:20
  • 9
  • 436
  • 0

Xem thêm

Từ khóa: