... explanations about
how a language achieves a global status”.
Some believe that easy grammar structures,
familiarity in vocabulary, and the rich in
culture. etc. make a global language and ... also claims that there are two main ways
to make it possible to make a language
global language . The first way is official
way, that is, a language can be chosen to be...
... work.
The first type of data, called A- data, is a travel infor-
mation data set harvested from the databases avail-
able on the web, e.g., Wikipedia and Google Map.
A- data consists of 1, 603 sentences ... of data, called Q-data, is the
edited transcription of a speech data set simulating
human-computer dialogues in a lab environment. Q-
data is intended for the system to learn to...
... for any sor~ of natural language like interface.
To the contrary, we have indirect empirical data that
supports the premise that a natural language llke
interface would be a disadvantage. For ... sure that given such a
powerful capability, what a group of users would end
up with would be very far from a natural language.
The argument is sometimes made that a natural...
... for manipulating data. Objects
can be classified into classes and instances. A class defines
a procedure [called a method) for handling incoming
messages of its instances. A class inherits ... 'ease' and whose value is 'subject '.
; a variable rrteasage holds the value of an incoming message and a
variable self points to the oSjeet itself.
clas...
... technique for automatic in-
formation retrieval (Deerwester et al., 1990), but
several studies (Landauer and Dumais, 1997) have
shown that LSA successfully mimics many hu-
man behaviors associated ... comparison
among four combinations of corpora and text units
for the LSA-based and the cooccurrence-based
861
Table 1: Comparison of mean correct rate among
the combinations of two cor...
... California Stanford University
4676 Admiralty Way, Suite 1001 Stanford, CA 94305
Marina del Rey, CA 90292 jahr@cs.stanford.edu
germann,knight,marcu,kyamada @isi.edu
Abstract
A good decoding algorithm ... pa-
per, we compare the speed and out-
put quality of a traditional stack-based
decoding algorithm with two new de-
coders: a fast greedy decoder and a
slow but optimal decoder th...
... Ishida S, Inoue A, Kan Y &
Yasumoto T (1995) Palytoxin analogs from the dino-
flagellate Ostreopsis siamensis. J Am Chem Soc 117,
5389–5390.
5 Taniyama S, Arakawa O, Terada M, Nishio S,
Takatani ... MINIREVIEW
Marine toxins and the cytoskeleton: a new view of
palytoxin toxicity
M. Carmen Louzao, Isabel R. Ares and Eva Cagide
Departamento de Farmacologia, Facultad de Veterinaria, Uni...
... Natl
Acad Sci USA 102, 4235–4239.
33 Shikata Y, Watanabe T, Teramoto T, Inoue A,
Kawakami Y, Nishizawa Y, Katayama K & Kuwada
M (1995) Isolation and characterization of a peptide
isomerase ... M, Teramoto T, Kumagaye KY, Nakajima K,
Watanabe T, Kawai T, Kawakami Y, Niidome T,
Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-
TK containing D-serine at position 46, but not syn-
thet...
... primer and probe
1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT
2fw ATCCCAGGAAACACCAGTAGA
10rev ATTGTTTTCTCTCAAGACCCAA
TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG
18Sfw CGCCGCTAGAGGTGAAATTC
18Srev TCTTGGCAAATGCTTTCGCT
TaqMan ... Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A,
Egashira Y, Sanada H & Shibata K (2002) Identifica-
tion and expression of a cDNA encoding human
a- amino-b-carboxymuconate-...
... Guanidinium chloride- and urea-induced unfolding of FprA,
a mycobacterium NADPH-ferredoxin reductase
Stabilization of an apo-protein by GdmCl
Nidhi Shukla
1
, Anant Narayan Bhatt
1
, Alessandro ... FprA and the 0.8 m
CaCl
2
-stabilized apo-protein and analysed it by monit-
oring the changes in tryptophan fluorescence as sum-
marized in Fig. 4A. For 0.8 m CaCl
2
-stabilized FprA,
a...