Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ... gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg...

Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

... exclusion,whereas phosphorylated EIIA activates adenylatecyclase (CyaA) and leads to an increase in the intra-cellular cyclic AMP (cAMP) level [1].Mathematical models of cataboliterepression in E. coli The ... molecular medicine. In systemsbiology, quantitative experimental data and mathe-matical models are combined in an attempt to obtaininformation on the dynamics and regulatory structures of the ... substrates using a mathematical model, and it wasshown that, in the case of non-PTS carbohydrates(carbohydrates that are not phosphorylated duringuptake, such as lactose or arabinose), a simple...

Tài liệu Báo cáo " Natural resources and environment in Cam Ranh bay and sustainable development orientation " doc

... ...

Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx

... Structural comparison of four representatives of class I of the superfamily of bacterial, fungal, and plant peroxidases. (A) N-terminal domain and (B) C-terminal domain of catalase–peroxidase from Haloarcula ... the parts coding for the N-terminal and C-terminal domains of the co rresponding genes (KatG) w ere t rea ted se pa rately. S eq uence data for Candida al bicans was o btained fromthe Stanford ... subbranch isparticularly interesting: the APX gene of a red algae(Galdieria partita) has a common origin with APXs fromgreen algae (Chlamydomonas sp. and Chlamydomonasreinhardtii) and all...

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... Use15¢-GAG GTG GAT CCG TGG GCC GCA-3¢ Forward mao, cloning 25¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ Reverse mao, cloning 35¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ Forward sad, cloning 45¢-CAT GTA AGC CCC ... metabolites in the medium of A. nicotinovo-rans pAO1 and growth of A. nicotinovorans pAO1 and A. nicotino-vorans lacking pAO1 on CH3-4-aminobutyrate, 4-aminobutyrate and CH3NH2as carbon source. ... CH3-4-aminobutyrate and not 4-aminobutyrate was the substrate of the AO and thus both MABO and AO have the same substrateled us to postulate two pathways for the catabolism of CH3-4-aminobutyrate...

Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

... stimulation did notalter the degradation rate with 60 and 40% of the pro-tein remaining at 3 and 6 h, respectively, both for theligand-activated and nonactivated Gaq. Adding newmedia containing ... muscarinic recep-tor 1 (M1R) and Gaq, showed the characteristicincrease in accumulation of inositol phosphates. Lig- and- induced release of inositol phosphates was againmarkedly increased after ... encoding for M1R (A) and Gaq and GaqR183C (B), Ga16 and M2R (C), Ga16 and Ga16Q212L (D), as indicated. Cells were metabolically labeled, stimula-ted with carbachol (10 lM) as indicated...

Tài liệu Báo cáo khoa học: "Contrasting Multi-Lingual Prosodic Cues to Predict Verbal Feedback for Rapport" pptx

... manually created for the Span-ish and Arabic data. Manual annotation of a broadrange of nonverbal cues, including gaze, blink, headnod and tilt, ﬁdget, and coverbal gestures, is under-way. ... task-oriented di-alog, identifying increases in pitch and intensity aswell as certain POS patterns as key contributors. In multi-lingual comparisons, (Ward and Tsukuhara,2000; Ward and Al Bayyari, 2007; ... et al., 2005), gaze (Watson, 1970),cues to vocal back-channel (Ward and Tsukuhara,2000; Ward and Al Bayyari, 2007; Rivera and Ward, 2007), nonverbal back-channel (Bertrand etal., 2007)), and...

Báo cáo khoa học: EspB from enterohaemorrhagic Escherichia coli is a natively partially folded protein pptx

... drawn only for visual assistance and is not a mathematical ﬁt.Fig. 5. Urea unfolding of EspB at various pH values and at 20 °C. (A) The far-UV CD spectra obtained in the presence and absence of ... Honda4 and Itaru Yanagihara11 Department of Developmental Infectious Diseases, Research Institute, Osaka Medical Center for Maternal and Child Health, Japan2 Department of Biotechnology, Graduate ... Takahashi A, Yanagihara I, Akeda Y,Imura K, Kodama T, Kono G, Sato Y, Iida T &Honda T (2002) Cortactin is necessary for F-actinaccumulation in pedestal structure induced by entero-pathogenic...

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... nrdF+ gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientiﬁc & Educational Software, Cary, ... (5¢-TTT TTC TAG AGC AGG GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB 3 (5¢-AAA AGA ATT CTT AGAAGT CCC AGT CAT CGT C-3¢; additional EcoRI siteunderlined).The ampliﬁed ... Brukersoftware, as described above.Analysis of metalsManganese and iron have been determined by GF-AAS and ICP-MS. [As a result of problems with the protein matrix in the analysis of metalloproteins,...

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression proﬁling ppt

... group of nine fat bodies were collected and RNA lev-els were analyzed using qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78,AaHR39, AaHR78 ... to increase again at peak vitellogenesis(18 + 24 h PBM). These transcripts (AaUSP -A, AabFTZ-F 1A , AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) werealso analyzed in our in ... analyzed, and Fig. 2 depicts the proﬁlematching both replicates.An increase in transcript abundance for AaEcRA,AaEcRB, AaE7 5A, AaE75B, AaE75C, AaHR3,AaHR4, AaE78 and AaHR39 occurred in both...

Xem thêm

Từ khóa: tài liệu báo cáo môn triết tài liệu báo cáo tài chính tài liệu báo cáo môn tài liệu báo cáo khoa học tài liệu báo cáo nghiên cứu khoa học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP