flux density of stars from a selection of published values in non si units

Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx

Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx

Ngày tải lên : 09/08/2014, 08:23
... and interpretation of data J-AN participated in study design, revision ofthe manuscript, and analysis and interpretation of data PG participated in study design, acquisition of data, revision ofthe ... (guarantor)participated in study design, acquisition of data, draft and revision ofthe manuscript, and analysis and interpretation of data TS participated in study design, revision ofthe manuscript, and ... questionnaire (HAQ) score, patient-scored visual analogue scale for pain (VASpain) and general health (VASglobal), physician's global assessment of disease activity on a five-grade scale (EVALglobal),...
  • 10
  • 502
  • 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Ngày tải lên : 05/03/2014, 15:20
... epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and resident training) In some ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
  • 14
  • 610
  • 0
Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

Ngày tải lên : 07/08/2014, 06:20
... to as pictures of weight k A card of weight k is a pair consisting of a picture of weight k and a k-element subset of N that we will call the label set of the card A hand of weight n and size ... self-adjoint equations Every second-order linear equation can be gauge-transformed into self-adjoint form, and as we saw above, spectral residue sequences are invariant with respect to gauge transformations ... k A card of weight k is a connected k-graph labelled by any k natural numbers Equivalently, a card can be specified as a picture and a set of natural number labels To construct the card we label...
  • 14
  • 348
  • 0
Tài liệu Báo cáo "Some laws of large numbers in non-commutative probability " docx

Tài liệu Báo cáo "Some laws of large numbers in non-commutative probability " docx

Ngày tải lên : 13/02/2014, 04:20
... law of large numbers for two-dimensional arrays of orthogonal operators Let A denote a von Neumann algebra with faithful normal state Φ, and N is set of all natural numbers For each self-adjoint ... sequences and martingale differences ˜ Let A be a von Neumann algebra with faithful normal tracial state τ ; A denote the algebra of measurable operators For every fixed r ≥ 1, one can define the Banach ... Banach spaceLr (A, τ ) of (possibly unbounded) operators as the non- commutative analogue of the Lebesgue spaces of rt h integrable random variables If B is a von Neumann subalgebra of A then Lr...
  • 9
  • 444
  • 0
Đề tài " Extension properties of meromorphic mappings with values in non-K¨ahler complex manifolds " pot

Đề tài " Extension properties of meromorphic mappings with values in non-K¨ahler complex manifolds " pot

Ngày tải lên : 22/03/2014, 16:20
... mappings into K¨hler a manifolds was proved using the result of Siu and a somewhat generalized classical method of “analytic disks” This method works well for mappings into K¨hler manifolds a ... which says that if h : A → S is a holomorphic injection of a finite dimensional analytic set A into a Banach analytic set S, then h (A) is also a Banach analytic set of finite dimension; see [Mz] For ... We shall prove that each Aj is pseudoconcave in ∆n and admits a Sadullaev potential We start with Lemma 2.10 The Aj are complete pluripolar and moreover admit a Sadullaev potential Proof Recall...
  • 44
  • 283
  • 0
nitrous oxide fluxes from a commercial beef cattle feedlot in kansas

nitrous oxide fluxes from a commercial beef cattle feedlot in kansas

Ngày tải lên : 28/05/2014, 14:38
... physical characteristics were first analyzed for normality using the univariate procedure in SAS 27 Normality for each individual factor was analyzed based on the complete dataset, then classified ... and arguments for the paper OAA, RM, CWR, SLT, and LEE made critical revisions and approved final version All authors reviewed and approved of the final manuscript DISCLOSURES AND ETHICS As a ... the chamber During each field sampling campaign, once the last gas sample was collected, a 10 cm soil/manure core was collected from the inside of each SFC for each pen In addition, in one of the...
  • 11
  • 260
  • 0
Báo cáo hóa học: "Prognostic Impact of MiR-155 in Non-Small Cell Lung Cancer Evaluated by in Situ Hybridization" pot

Báo cáo hóa học: "Prognostic Impact of MiR-155 in Non-Small Cell Lung Cancer Evaluated by in Situ Hybridization" pot

Ngày tải lên : 18/06/2014, 16:20
... adenocarcinomas (ACs), 31 large cell carcinomas and 18 bronchioloalveolar carcinomas Due to nodal metastasis or non- radical surgical margins, 59 (18%) patients received adjuvant radiotherapy Interobserver ... Hoque A, et al: Prognostic significance of differentially expressed miRNAs in esophageal cancer Int J Cancer 2011, 128:132-43 37 Yamanaka Y, Tagawa H, Takahashi N, et al: Aberrant overexpression of ... Y, Nakajima G, Gavin E, et al: Systematic analysis of microRNA expression of RNA extracted from fresh frozen and formalin-fixed paraffin-embedded samples RNA 2007, 13:1668-74 36 Hu Y, Correa AM,...
  • 9
  • 662
  • 0
Báo cáo hóa học: " Inhibition of cytokine gene expression and induction of chemokine genes in non-lymphatic cells infected with SARS coronavirus" doc

Báo cáo hóa học: " Inhibition of cytokine gene expression and induction of chemokine genes in non-lymphatic cells infected with SARS coronavirus" doc

Ngày tải lên : 20/06/2014, 01:20
... 30% of cases patients also developed an atypical form of pneumonia [8] The mechanisms underlying SARS-CoV-mediated pathogenesis remain largely unexplained Autopsies from deceased patients revealed ... studies and the RT-PCR analyses, participated in the design of the study, and has given final approval of the version to be published FW carried out virus infections, participated in the design of ... RA, Rimmelzwaan GF, Van Amerongen G, Van Riel D, De Jong T, Itamura S, Chan KH, et al.: Pegylated interferon-alpha protects type pneumocytes against SARS coronavirus infection in macaques Nat...
  • 9
  • 387
  • 0
Báo cáo toán học: "Invariant and coinvariant spaces for the algebra of symmetric polynomials in non-commuting variables" pps

Báo cáo toán học: "Invariant and coinvariant spaces for the algebra of symmetric polynomials in non-commuting variables" pps

Ngày tải lên : 08/08/2014, 12:23
... coefficient in (16) Analyzing the abelianization map ab : T → S (the map making the variables x commute), Rosas and Sagan [15, Thm 2.1] show that ab|N satisfies: ab(mA ) = λ (A) ! mλ (A) (19) In particular, ... {A1 , A2 , , Ar } is the (integer) partition λ( |A1 |, |A2 |, , |Ar |) obtained by sorting the part sizes of A in increasing order, and its length ℓ (A) is its number of parts (r) Observing ... we have j < k Reordering the entries of a composition a in decreasing order results in a partition λ (a) called the shape of a Summing over monomials ya with the same shape leads to the monomial...
  • 17
  • 364
  • 0
Báo cáo y học: "Chemical restraint in routine clinical practice: a report from a general hospital psychiatric ward in Greece" ppsx

Báo cáo y học: "Chemical restraint in routine clinical practice: a report from a general hospital psychiatric ward in Greece" ppsx

Ngày tải lên : 09/08/2014, 01:21
... harmonisation of the practices of Greek units with other units worldwide Author details Department of Psychiatry, General Hospital of Arta, Arta, Greece 2Private Practice, Ioannina, Greece Authors’ ... antipsychotics are effective and reasonably safe for use in rapid tranquilisation The limited availability of lorazepam in our unit provides a rationale for the extensive use of antipsychotics (73.2% of injections) ... the availability of atypical antipsychotics parenteral formulations in our unit The reasons for this are not known, but we assume that practicing clinicians are more familiar with the parenteral...
  • 3
  • 336
  • 0
RBF interpolation of boundary values in the BEM for heat transfer problems

RBF interpolation of boundary values in the BEM for heat transfer problems

Ngày tải lên : 16/06/2016, 01:11
... interpolation of standard Gaussian quadrature can be applied while the weakly singular boundary values integrals are evaluated by using the well-known numerical techniques as in the case of the standard ... CPV integral is now written in the non- singular form, where the standard Gaussian quadrature can be applied For weakly singular integrals, some well-known treatments such as logarithmic Gaussian ... boundary adequately and how to evaluate the integrals accurately, especially in the cases where the moving field point coincides with the source point (singular integrals) In the standard BEM (Banerjee...
  • 22
  • 446
  • 0
Báo cáo hóa học: " Nano-regime Length Scales Extracted from the First Sharp Diffraction Peak in Non-crystalline SiO2 and " docx

Báo cáo hóa học: " Nano-regime Length Scales Extracted from the First Sharp Diffraction Peak in Non-crystalline SiO2 and " docx

Ngày tải lên : 22/06/2014, 00:20
... partial structure factor, SN(Q) ij associated with Si O, O–O and Si Si pair correlation distances have been determined using classical molecular dynamics simulations as addressed in [8] Combined ... calculation play a determinant role in generating a stable minimum for a Si O Si bond angle, H, that is smaller than the ionic bonding value 180° In addition these values of H, and the bond angle distribution, ... on internal grain boundaries of nano-grains large enough to display J–T term splittings [28] These are indicated in Fig Nano-grain HfO2 in the MRO size regime of 1.5–2 nm can also formed in phase-separated...
  • 9
  • 303
  • 0
báo cáo khoa học: " Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein kinase C pathway in non-small cell lung cancer" pdf

báo cáo khoa học: " Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein kinase C pathway in non-small cell lung cancer" pdf

Ngày tải lên : 10/08/2014, 10:20
... Biotechnology (catalog number COX 229, Camarillo, CA, USA), antibody against human VEGF was obtained from Santa Cruz Biotechnology (catalog number C-1, Santa Cruz, CA, USA), and antibody against human CD34 ... of each sample was studied using hematoxylin and eosin (H&E) staining, and histological typing was determined according to the World Health Organization (WHO) classification [15] Tumor size and ... Dohadwala M, Dubinett SM: Prostaglandin E2 activates mitogen-activated protein kinase/Erk pathway signaling and cell proliferation in non- small cell lung cancer cells in an epidermal growth factor...
  • 10
  • 265
  • 0
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc

Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc

Ngày tải lên : 28/03/2014, 22:20
... 914–920 Tamamura H, Imai M, Ishihara T, Masuda M, Funakoshi H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al (1998) Pharmacophore identification of a chemokine receptor (CXCR4) antagonist, ... et al HCDR3-derived CXCR4 antagonists Table Analysis of the frequency of individual amino acids as a function of the heavy chain complementarity determining region (HCDR3) length Amino acid Pearson’s ... results were in agreement with the analysis on a large set of HCDR3 sequences retrieved from antibody databases by Zemlin et al [35] Analysis of individual amino acid contents as a function of HCDR3...
  • 12
  • 299
  • 0
Báo cáo lâm nghiệp: "Climatic significance of tree-ring width and intra-annual density fluctuations in Pinus pinea from a dry" pdf

Báo cáo lâm nghiệp: "Climatic significance of tree-ring width and intra-annual density fluctuations in Pinus pinea from a dry" pdf

Ngày tải lên : 07/08/2014, 16:20
... the coastal and inland area Climatic significance of IADFs in Pinus pinea 233 Figure Ring-width indices chronologies of Pinus pinea growing in the coastal and in the inland area The dot line represents ... growing season IADFs in teak have also been observed in association with insect defoliation [44] In southern Patagonia (Argentina), Masiokas and Villalba [40] noted that anomalously dry warm springs ... area (Tab I) Values of mean sensitivity and standard deviation were higher for latewood than for earlywood and tree-ring width at each area In both areas, a high first-order autocorrelation was...
  • 10
  • 407
  • 0
Báo cáo lâm nghiệp: "Radial distribution of sap flux density in trunks of a mature beech stand" pot

Báo cáo lâm nghiệp: "Radial distribution of sap flux density in trunks of a mature beech stand" pot

Ngày tải lên : 07/08/2014, 16:21
... probably intercepting enough light or had an aboveaverage leaf area/basal area ratio Vincke et al [27] found that Radial sap flow in beech trunks SFD variability was larger in a thinned than in an ... [1,2,4,17] Diurnal values of transpiration of individual trees are then a stratified random sample, the transpiration in mm being calculated from them via the basal area of the stand [5] This procedure, ... S., Kakubari Y., In uences of environmental factors on the radial profile of sap flux density in Fagus crenata growing at different elevations in the Naeba Mountains, Japan, Tree Physiol 25 (2005)...
  • 8
  • 276
  • 0
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

Ngày tải lên : 23/09/2012, 15:38
... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... medical liquid wastes Liquid medical wastes can be treated much more easily by using one of the latest technologies – Biofast – a kind of machine for filtering liquid wastes Biofast are outstanding ... contain dirty mineral substances, disinfectants and radioactiveness Liquid wastes spread very fast because of bacteria, especially liquid wastes from infectious hospitals For liquid wastes, all...
  • 10
  • 722
  • 0
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Ngày tải lên : 03/11/2012, 11:44
... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the ... Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; QoL: Quality of Life; RF: Radio...
  • 9
  • 679
  • 0
Evaluation of Nutrient Loads from a Citrus Orchard in Japan

Evaluation of Nutrient Loads from a Citrus Orchard in Japan

Ngày tải lên : 05/09/2013, 10:15
... Study Area Study area including in a citrus orchard is located in Shizuoka Prefecture, in central Japan (Fig 1) This area is famous in Japan for the production of high quality mandarin oranges ... concentration and water discharge at the downstream site during the intensive sampling period Rain data quoted 10-minute interval precipitation in the Automated Meteorological Data Acquisition ... estimated in Cases and are shown in Table Table - Evaluation of nutrient loads and water discharge for each case at the downstream site (watershed area of 78.3 ha) TN load TP load (kg/yr) Case 2004...
  • 10
  • 425
  • 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Ngày tải lên : 05/09/2013, 10:15
... cultivation Table shows the strains examined in this study MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) MD-1 strain can degrade the microcystin analogs, microcystin-RR, ... Water Quality., 13, 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from ... (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al.,...
  • 9
  • 522
  • 0

Xem thêm