fi city of the cocoa aspartic endoprotease is essential for generation of cocoa speci fi c aroma precursors
Báo cáo khoa học: The mitochondrial protein frataxin is essential for heme biosynthesis in plants potx
Ngày tải lên :
28/03/2014, 23:20
... proteins with either of two isoforms of FC from cucumber were targeted to plastids, but not to mitochondria Indeed, the speci c antibodies against either of the two isoforms of FC detected signals ... investigate the effect of AtFH deficiency on heme content and the activity of hemeproteins in Arabidopsis plants Construction of the antisense as-AtFH line and phenotypic characterization The Arabidopsis ... activity associated with the mitochondria fraction where CAT3 is the main isoform These results are in accordance with hemin rescue experiments performed in frataxindeficient neuronal cells, which showed...
- 12
- 517
- 0
LUẬN MẪU LỚP 12 Discuss the view that tolerance is essential for peace and harmony in any community or country
Ngày tải lên :
15/07/2015, 23:19
... which has become the envy of many countries The racial unity among the people is the main factor that has contributed to the progress of the country in all spheres of activity Another country that ... The efficiency of the administrative organs of the state would also be increased, and in time of national crises, the government could draw on the intellectual resources of the people Even the younger ... it has become the richest country in the world All this proves what could be achieved by the people of a community or country who exercise tolerance among themselves New words: tolerance (n):...
- 13
- 302
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
Ngày tải lên :
16/03/2014, 01:20
... pcDNA3.1-HSP70DPBD Antisense of pcDNA3.1-HSP70DPBD Sense of pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC ... CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC TCGGGTACCGGATCTACCTCCTCAATGGTG FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª ... molecules such as cytochrome c, Smac ⁄ DIABLO and apoptosis-inducing factor (which activate caspase cascades) through the mitochondrial transition pore [30] Bcl-2 is the prototype of the bcl-2...
- 10
- 726
- 0
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
Ngày tải lên :
17/03/2014, 10:20
... 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C1 59S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C1 76S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) ... one conformation, this arm brings the CGC close to the redox-active centre of the other monomer, while in the second conformation the arm reaches out to the open space Thus, the CGC motif on the ... exchange the de novo synthesized disulfides from the CXXC motif of the primary redox-active centre and passes them on to speci c substrates Erv1p lacks the C- terminal CGC motif, but possesses the...
- 8
- 405
- 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
Ngày tải lên :
23/03/2014, 20:22
... Grants-in-Aid for Scienti c Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan and from Japan Society for the Promotion of Science (to T K N.) References Borkovich, ... reflect its potent client-binding capacity located in the C- terminal domain The perfect dimer configuration of the HSP90-family protein seems to be accomplished through a pair of the intermolecular ... dimerization of HSP90, and the other, the identification of the minimal region of the C- terminal domain for the client binding Bearing in mind the fact that the 35-amino-acid residues corresponding to the...
- 9
- 364
- 0
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
Ngày tải lên :
30/03/2014, 04:20
... but crucial function of the protein during adaptation of bacteria to speci c environment Hence, dissection of the various biochemical activities of RecD might be relevant for its in vivo function ... activity of the recombinant wild-type RecD protein (RecDHis) of P syringae, which is an essential activity of any helicase motor The RecDHis displayed efficient ATPase activity in the presence of ssDNA ... sequence and RecA recombinase in the cell [4,38,39] Although all the subunits of RecBCD contribute towards the activities of the complex, the RecD subunit in E coli is required for the exonuclease...
- 17
- 326
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
Ngày tải lên :
31/03/2014, 08:20
... Thermoanaerobacter ethanolicus Escherichia coli Bacillus cereus S cerevisiae (MAL3S) Desulfurococcus mucosus Sulfolobus acidocaldarius Pseudomonas amyloderamosa Bacillus circulans Leuconostoc ... Black gram Hog Bacillus subtilis Aspergillus oryzae Saccharomycopsis buligera Bacillus stearothermophilus Bacillus acidopullulyticus Escherichia coli Bacillus amyloliquefaciens Bacillus licheniformis ... Leuconostoc mesenteroides Streptococcus mutans Leuconostoc mesenteroides Neisseria polysaccharea Thermotoga maritima Thermus aquaticus Chlamydia trachomatis Synechocystis sp Potato Arabidopsis...
- 14
- 557
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
Ngày tải lên :
13/08/2014, 09:21
... outgrowth of CTLL-2/Tax cells in the absence of IL-2 PBM is essential for outgrowth of CTLL-2/Tax cells in the absence of IL-2 (A, B) CTLL-2 cells (107) were transfected either with the vector plasmid ... 2) These characterized cells were then cultured in the absence of IL2 for 3–5 days CTLL-2 cells transfected with a control plasmid (pβAIP) did not grow in the absence of IL-2, and most of the cells ... with the induction of IL-2-independent growth of CTLL-2 [37] However, NF-κB does not account for cell death of CTLL2/Tax C cells in the absence of IL-2, since Tax C has equivalent NF-κB activity...
- 7
- 177
- 0
Báo cáo y học: " Number of active transcription factor binding sites is essential for the Hes7 oscillator" pptx
Ngày tải lên :
13/08/2014, 23:20
... represses the transcription of Hes7 completely Then the response function is the long-term relative frequency of occupation of one of the binding sites in dependence on the protein concentration ... region of Hes7 Details are reported in the results section Results Estimation of the hill coefficient We calculated the Hill coefficient of the response function (1) for two scenarios (A) The equilibrium ... recently proposed in [10], which mimics the chemical reactions model for ligand binding in [11,12] In this approach, the transcriptional activity of the Hes7 promoter and its dependence on the...
- 6
- 180
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
Ngày tải lên :
07/03/2014, 05:20
... 5¢-CGACCTATGGCGAGGCGCACTGCAAGTCG3¢, and reverse primer, 5¢-CGACTTGCAGTGCGCCTCGC CATAGGTCG-3¢; S127A, forward primer, 5¢-GCGGCCG CTCTGCCGCCCGCGAGACC-3¢, and reverse primer, 5¢-GGTCTCGCGGGCGGCAGAGCGGCCGC-3¢ For ... amino acid replacements significantly affected the utilization of NADPH as a source of reducing equivalents for activation of the cofactor to its reduced form Chorismate synthase activity of the ... catalytic cycle an electron (or negative charge) is redistributed to maintain the reduced form of the flavin cofactor [8–11] The theoretical and experimental evidence for such a role of the reduced...
- 10
- 398
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
Ngày tải lên :
17/03/2014, 23:20
... 5¢-GGCCATTGGCTGGCCTTaatGCACAGCGGATCG ATTTTC-3¢; MREc mut, 5¢-CCAGTACAGTGTCGG AGCattCCAGCGCGAGGTGGCCG-3¢; MREd mut, 5¢-CGGGAGGACGGCGGCGCattACTTTGAATCAT CCGTG-3¢ Mutations in the MREs were identified and confirmed by ... oligonucleotides for 30 at 25 C The oligonucleotide sequences used as the 32P-labelled probes and competitors were: MREa, 5¢-GGGCGCC TGCGCCCCCGTTCC-3¢ ()441 to )421); MREa mut1, 5¢-GGGCGCCAATGCCCCCGTTCC-3¢; ... mutagenesis, with the trinucleotide mutations indicated in lowercase letters (underlined bases denote the MRE core sequence): MREa mut, 5¢-GGGCGCCaatGCCCCCGTTCC-3¢; MREe mut, 5¢-GGCCATTGGCTGGCCTTaatGCACAGCGGATCG...
- 11
- 628
- 0
Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf
Ngày tải lên :
23/03/2014, 10:21
... (Qiagen) The sequences of the oligonucleotides used in the amplification of SEP53 are: forward 5¢-CATA GCTCGAGCTATGCCTCAGTTACTGCAAAACATT-3¢; reverse 5¢-CAGTCAAGCTTCATGGCTTGGTGCTTCT CAAGT-3¢ Oligonucleotides ... SEP53, forward 5¢)3¢ CAGTC AAGCTTATGCCTCAGTTACTGCAAAAC and reverse 5¢)3¢ CATAGCTCGAGTCATGGCTTGGTGCTTCTC; (b) DCa–SEP53, forward 5¢)3¢ TGCTAGAATTCAGATC TATGAGCGAGAGTGCTGAGGGA and reverse 5¢)3¢ TGCTATCTAGATCATGGCTTGGTGCTTCT ... bile acids (as well as cholesterol, Fig 2E), including DCA, chenodeoxycholic acid (CDCA), ursodeoxycholic acid (UDCA), lithocholic acid (LCA) and cholic acid (CA), with both conjugated and unconjugated...
- 18
- 370
- 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
Ngày tải lên :
06/08/2014, 18:21
... removal of Imp-L2 function did not rescue either chico or PI3K mutant phenotypes (data not shown) are consistent with the hypothesis that Imp-L2 acts upstream of the intracellular IIS cascade at the ... any clear ortholog of the classical IGFBPs with their characteristic amino-terminal IGFBP motifs, invertebrates such as flies can regulate IIS activity at the level of the ligands as a result of ... the clone, the size of the ommatidia is reduced Wild-type ommatidia close to the clone are also smaller (compare black circled areas) (b) Eye-specific overexpression of UAS-s.Imp-L2 reduces male...
- 11
- 345
- 0
báo cáo khoa học: " Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight" pptx
Ngày tải lên :
12/08/2014, 05:20
... (Invitrogen) The primers used for amplification included 5' CACC CAA CAC CAT CTG CTA CCA AAA A 3'(forward) and 5' GAC ACT GGG TCA GCG TTG TG 3'(reverse) A 481-bp cDNA fragment from Sgt1, corresponding ... Atlantic (BC2) and Katahdin (BC3) K41 is a late blight resistant BC3 clone Presence of the RB gene in K41 was confirmed by polymerase chain reaction (PCR) using RB-specific primers [43] and this clonal ... phenotypic changes Late blight resistance evaluation of the Rar1 and Sgt1 silenced lines showed that the Sgt1 gene is essential for the RB-mediated late blight resistance In contrast, silencing of the...
- 9
- 303
- 0
Mypt1 mediated spatial positioning of bmp2 producing cells is essential for liver organogenesis
Ngày tải lên :
11/09/2015, 16:06
... into the space of Disse and so makes intimate contact, facilitating exchange, with the hepatocyte (Figure 1-4) The hepatocyte is the main cell type accounting for 60% of all liver cells It is the ... with the cystic duct from the gallbladder to form the common bile duct The common bile duct merges with the main pancreatic duct in the hepatopancreatic ampulla that enters the duodenum at the ... functions during hepatic specification Double knock–out both factors is a probable way to obtain the direct evidence of the indispensability of Gata factors in the hepatic competency establishment...
- 195
- 233
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... by the complicated relationship between ECs and non-ECs such as mural, hematopoietic and mesenchymal fibroblast cells, even though a conditional genetic modification such as endothelium -speci c ... examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds 1994 Construction of the transgene ... G418-resistant colonies were picked and expanded for PCR genotyping and the formation of embryoid bodies One ESC clone (T26) out of 48 G418-resistant clones was further examined for the presence of the...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc
Ngày tải lên :
19/02/2014, 07:20
... AATATACGGTTCATGGCAATACTGT CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT CGA GCT TGC TTT ACA TCA GCC TGT GTC ATC TAG GGT GAA GCC GGC TTC AAG GTT ACT TCG CGG TGG GGC ACC AGC TTG TAA TGG GGC GAA TCG ... CaN CaMKII COX I COX Vb F1-ATPase b GGC TCC ATC TGC TTG TCC ATG GAA GCG GTT ACT CCA GTA TTG GAG CTG AAC GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT ... using the optimal number of PCR cycles (midpoint of the logarithmic range) This was 27 cycles (in the case of SERCA 2a), 28 cycles (CaN), 35 cycles (CaMKII) or 25 cycles (GAPDH), consisting of denaturation...
- 13
- 578
- 0
Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx
Ngày tải lên :
07/03/2014, 00:20
... ) ES cells is not aberrant expression of these cell cycle regulators To further investigate the mechanism of the cell proliferation defect seen in Ptb) ⁄ ) ES cells, we performed cell cycle analysis ... USA) Mice and teratoma formation C5 7BL ⁄ 6J mice and MCH:ICR mice were purchased from CLEA Japan (Tokyo, Japan) All of the mice were maintained under speci c pathogen-free conditions in the animal ... Yoshida) for the Future Program (‘Mirai Kaitaku’) from the Japanese Society for the Promotion of Science (JSPS) and by grants from the Ministry of Education, Culture, Sports, Science and Technology of...
- 11
- 454
- 0
Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc
Ngày tải lên :
16/03/2014, 22:20
... (crabp1b; 3¢-RACE: 5¢-GCTAACAGATCAATAGGCTTC-3¢, 5¢-GATTTGAA AGCAAGAGGGTC-3¢; 5¢-RLM-RACE: 5¢-TTAGACGC AGCCGCACAAG-3¢, 5¢-CGGCCATCGACGGTCTC-3¢) Three 3¢-RACE cDNA and 5¢-RLM-RACE clones of each gene ... GenBank accession number BI533516), which had sequence similarity to the mammalian CRABPI cDNA (crabp1a; 3¢-RACE: 5¢-CCC AACTTCGCCGGCACCTGG-3¢, 5¢-TGAAAGCTCTCG GCGTAAAC-3¢; 5¢-RLM-RACE: 5¢-GAGCTTTCAGA ... Duplicated crabp1 genes in zebrafish A B Fig Tissue -speci c distribution of the zebrafish crabp1a and crabp1b transcripts in adult zebrafish (A) Tissue -speci c RT-PCR products were generated using cDNA...
- 11
- 312
- 0
Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
Ngày tải lên :
18/06/2014, 22:20
... in the absence of TET shows only immature virus particles suggests the hypothesis that there is a requirement for the processing threshold of the core protein precursors to be achieved before ... which the formation of plaques from vtetOI7L is dependent on the presence of TET, while the wild-type virus is unaffected by either the presence or absence of TET To determine the optimum TET concentration ... protein precursor cleavage and the initiation of core condensation Following this activity, the activation of G1L completes core condensation and allows progression to the formation of intracellular...
- 6
- 300
- 0