an optimized footprint is needed and function specific modules can utilize larger capacity components and share clearances to provide a greater kw per square foot or square meter
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... stimulated or not with PMA for 24 h GPVI was a nity-precipitated using convulxin and detected by ligand blotting as a band of 55 kDa Additional bands of lower molecular mass are indicated The associated ... 530 nm and emission wavelengths of 330 nm and 380 nm The ratios of Fura-2 emissions were measured and analyzed using phycoerythrin FWINLAB software Ratiometric analysis was converted into a concentration ... 157–163 11 Santoro, S .A. , Walsh, J.J., Staatz, W.D & Baranski, K.J (1991) Distinct determinants on collagen support alpha beta integrinmediated platelet adhesion and platelet activation Cell Regul...
- 10
- 506
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total a- tubulin (DM 1A) , peroxidase-conjugated rabbit antimouse IgG, rhodamineconjugated goat antirabbit, and fluorescein-conjugated goat antimouse ... dried and scanned with a Duoscan T1200 (Agfa) connected to a PC, and optical density values determined using the Scion Image program Experimental values were standardized relative to total tubulin ... adjuvant, was injected subcutaneously every 15 days The antisera were usually collected 15 days after each injection and tested for affinity and specificity and stored at )20 °C Mouse monoclonal...
- 9
- 518
- 0
Báo cáo hóa học: " Research Article An Efficient Addressing Scheme and Its Routing Algorithm for a Large-Scale Wireless Sensor Network" pptx
... 3D AACS routing algorithm, a root router and a coordinator compare the x values of a destination and coordinator whether a packet is to be sent to a parent root router or a child root router A ... TRAACS algorithm and traditional Cskip based tree-based routing algorithm for ZigBee network The Cskip algorithm assumes two network parameters, Cm and Rm A performance metric used for this evaluation ... Communications and Networking Conference (WCNC ’02), vol 1, pp 350–355, Orlando, Fla, USA, March 2002 [9] W R Heinzelman, A Chandrakasan, and H Balakrishnan, “Energy-efficient communication protocol for...
- 13
- 366
- 0
Báo cáo khoa học: "Using Lexical Dependency and Ontological Knowledge to Improve a Detailed Syntactic and Semantic Tagger of English" pot
... database, and an automatically acquired ontology made by clustering words in a large corpus of unannotated text We have chosen to use hierarchical schemes for both the automatic and manually acquired ... Black, S Eubank, H Kashioka, and J Saia 1996b Reinventing part-of-speech tagging Journal of Natural Language Processing (Japan), 5:1 Rada Mihalcea and Dan I Moldovan 1998 Word sense disambiguation ... broad-coverage semantic -and- syntactic tagsets for natural language: The atr approach In Proceedings of ICCPOL-2001 Xiaobin Li, Stan Szpakowicz, and Stan Matwin 1995 A wordnet-based algorithm for word...
- 8
- 423
- 0
terrorism and development using social and economic development to inhibit a resurgence of terrorism
... after Arafat declared a moratorium on acts of terrorism perpetrated outside Israel and the Occupied Territories 4Kass and O’Neill, 1997, pp 215–236; Abu-Amr, 1993, p 10; and Mishal and Aharoni, ... the Real Irish Republican Army (RIRA) Commercial interest groups have also acted as a brake on Republican and Loyalist violence, discouraging the retaliatory riots and attacks that traditionally ... however, and the PLO began to call for a separate Palestinian state For further discussion on the history of the Arab-Israeli conflict and the Palestinian refugees see Morris (1999, pp 174–249), and...
- 61
- 337
- 0
terrorism and development using social and economic development to inhibit a resurgence of terrorism
... after Arafat declared a moratorium on acts of terrorism perpetrated outside Israel and the Occupied Territories 4Kass and O’Neill, 1997, pp 215–236; Abu-Amr, 1993, p 10; and Mishal and Aharoni, ... the Real Irish Republican Army (RIRA) Commercial interest groups have also acted as a brake on Republican and Loyalist violence, discouraging the retaliatory riots and attacks that traditionally ... however, and the PLO began to call for a separate Palestinian state For further discussion on the history of the Arab-Israeli conflict and the Palestinian refugees see Morris (1999, pp 174–249), and...
- 61
- 284
- 0
báo cáo khoa học: "Partial abdominal evisceration and intestinal autotransplantation to resect a mesenteric carcinoid tumor" potx
... grew Candida albicans) and a final laparotomy for abdominal washout with saline containing amphotericin B and gentamicin He did have a small leak at his pancreaticoileostomy that was managed ... aorta, distal superior mesenteric artery and aorta, and between the distal superior mesenteric vein and cephalad portal vein A similar approach was employed by Tzakis and colleagues to treat four ... pancreatectomy, gastrectomy, splenectomy and hepatic revascularization (as his proximal hepatic artery was also resected) Vascular anastomoses were performed between the hepatic artery and aorta,...
- 6
- 447
- 0
Báo cáo y học: ": Gastrointestinal relapse of multiple myeloma and sustained response to lenalidomide: a case repo" pps
... wrote the manuscript with support from TAM and PYD TAM and XM reviewed and interpreted the pathology slides and CT scan images, respectively All authors read and approved the final manuscript ... with lenalidomide total, over a period of twenty days His platelet count and coagulation parameters were normal A bleeding, ulcerated jejunal mass was revealed by an upper gastrointestinal endoscopy ... tract Consent Written informed consent was obtained from the patient’s next-of-kin for publication of this case report and any accompanying images A copy of the written consent is available for...
- 3
- 349
- 0
Báo cáo y học: " Using patient and physician perspectives to develop a shared decision-making framework for colorectal cancer" pptx
... patients and physicians in the setting of colorectal cancer in Canada or elsewhere We interviewed Ontario colorectal cancer patients who varied by age, gender, and stage of care, and found that ... doctors' support of shared decision-making in cancer care Br J Cancer 2007, 971:6-13 Charles C, Gafni A, Whelan T: Self-reported use of shared decision-making among breast cancer specialists and ... Huang H, Victor C, McLeod RS, Kennedy ED: Physicians' awareness and attitudes towards decision aids for cancer patients Canadian Journal of Surgery 2008, 51(Suppl) :A4 5 Gravel K, Legare F, Graham...
- 5
- 282
- 0
báo cáo khoa học: " Using patient and physician perspectives to develop a shared decision-making framework for colorectal cancer" docx
... patients and physicians in the setting of colorectal cancer in Canada or elsewhere We interviewed Ontario colorectal cancer patients who varied by age, gender, and stage of care, and found that ... doctors' support of shared decision-making in cancer care Br J Cancer 2007, 971:6-13 Charles C, Gafni A, Whelan T: Self-reported use of shared decision-making among breast cancer specialists and ... Huang H, Victor C, McLeod RS, Kennedy ED: Physicians' awareness and attitudes towards decision aids for cancer patients Canadian Journal of Surgery 2008, 51(Suppl) :A4 5 Gravel K, Legare F, Graham...
- 5
- 279
- 0
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc
... development and analysis, and participated in drafting the manuscript Additional material Additional File Data of crossings between A ipaënsis (accession K30076) and A magna (K30097) The data provides ... these, 12 markers were skewed towards A magna, three markers towards A ipaënsis, and 17 towards the heterozygote Linkage groups B2 and B10 had all distorted markers with an excess of A magna alleles, ... found in many intraspecific maps [46-48] Linkage groups B2 and B10 had all distorted markers with an excess of A magna alleles, while LG B1, B4, and B7 had all distorted markers skewed towards the...
- 10
- 399
- 0
Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf
... systems project to association cortices, such as the parieto-temporo-occipital and prefrontal, and then to the transitional cortex, including entorhinal, parahippocampal and perirhinal areas of the ... Hypothalamic-Pituitary-Adrenal Axis (HPA Axis) The hypothalamo-pituitary-adrenocortical (HPA) axis plays a fundamental role in adaptation of the organism to homeostatic challenge, and should be thought of as ... projects to central, basal and basal accessory nuclei of the amygdala [28], as well as to the hippocampus, orbitofrontal cortex, cingulate [29] and via the reticular activating system to the sensory...
- 13
- 382
- 0
Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast docx
... separated on an SDS Laemmli gel, transferred to nitrocellulose membrane and analyzed by a western blot analysis using anti-HA and anti-LeIF IgG The results showed that the recombinant HA-tagged ... (Contrat programme 2004-08 grant to IG) and by a Swiss National Science Foundation grant to PL References de Almeida MC, Vilhena V, Barral A & Barral-Netto M (2003) Leishmanial infection: analysis ... IF41 and IF42 are identical between mice and humans while DDX48 shows only three differences IF41 and IF42, also called eIF4AI and eIF4AII, are known translation initiation factors in mammalians,...
- 15
- 263
- 0
báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf
... (Angola, Cameroon, Comoros, Gambia, Malawi, Mali, Sao Tome and Principe, and Togo) with medians ranging from 17.1% to 4.5%; two (Equitorial Guinea and Swaziland) have statistically significant ... for South Africa seemed to be trending towards improvement with a negative median fractional change Four of these countries (Kenya, Uganda, Tanzania and Zambia) had statistically significant improvements ... eliminated Data analysis Data was compiled onto an Excel spreadsheet (Microsoft Excel, Microsoft Corporation, Redmond, WA) and translated into a native SAS format using DBMS/Copy® (Dataflux Corporation,...
- 9
- 342
- 0
Báo cáo y học: "DEK binding to class II MHC Y-box sequences is gene- and allele-specific" pptx
... indicates a potential role for DEK in modulating normal and abnormal immune response Materials and methods Cell culture and preparation of nuclear extracts Cultured cell lines were grown and harvested ... was exposed to a phosphor screen overnight, and the bands were quantified using a Molecular Dynamics Storm 840 Phosphorimager with ImageQuant Software The data were fit via nonlinear least-squares ... of radiolabeled probe containing DQA1*0101 Y-box sequence: lane 2, no antibody reagent; lane 3, µl normal human serum; lane 4, µl high-titer anti-DEK human antiserum; lane 5, µl anti-NF-YA (subunit)...
- 8
- 331
- 0
Báo cáo khoa học: " What is an acceptably smoothed fluence? Dosimetric and delivery considerations for dynamic sliding window IMRT" ppt
... values obtained for the s80 and s25 experiments and are averaged over all target volumes and organs at risk As for figure 4, data refer to the AAA dose calculation algorithm and to a calculation ... 5-field and one 7-field plans) were obtained from the dose plans A total of 36 dose plans and 204 modulated beams were compared and fed into the analysis process The analysis was stratified at multiple ... verification analysis For the two dose calculation Table 2: DVH analysis: differences between plans obtained with s80 and s25 Reported are the mean, SD, range and p value Data are averaged over...
- 13
- 332
- 0
báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx
... one-way repeated measures ANOVA Prospective audit Analysis of all unplanned ICU admissions and cardiac arrests will be performed over an eight-week period Page of before the intervention and an eight-week ... been taken and transposed to the observation chart If the patient Table Medical emergency team call criteria or triggers Airway Respiratory Distress Threatened Airway Breathing Respiratory Rate ... Street, Toronto, Canada 5Southern Health Quality Unit, Monash Medical Centre Clayton Clayton Road, Clayton, Melbourne, Australia 6Monash Medical Centre Intensive Care Unit, Clayton Road, Clayton,...
- 7
- 436
- 0
Báo cáo khoa hoc:" Effects of bone marrow cell transplant on thyroid function in an I131-induced low T4 and elevated TSH rat model" docx
... this paper GM: participated in the organ extraction and performed histological cuts and histological analysis JEMC: Supervised and participated in the design of the study and the writing of this ... rats BGC: carried out the DNA extraction NAC: carried out organ extraction and participated in the DNA extraction and in the real time PCR AD: performed the statistical analysis and participated ... helped and supervised all tests and analysis during the study Also performed the BM derived cells transplants JAC: carried out the ELISA and EIA tests AAGR: carried out the blood extraction and...
- 8
- 270
- 0
Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx
... manuscript NI conceived the study, carried out proliferation assays and bioassays, data analysis and the design, coordination, the draft and finalisation of the manuscript All authors read and ... homeostasis and function in advanced HIV disease Science 1997, 277:112-6 Li TS, Tubiana R, Katlama C, Calvez V, Ait Mohand H, Autran B: Long-lasting recovery in CD4 T-cell function and viral-load ... software (Statview 5.01; Abacus, Berkeley, CA) was used for all statistical calculations Data are presented as median (inter-quartile range IQR) Analysis of data between the different groups was performed...
- 11
- 365
- 0
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx
... TTGCCCAGTCAGGACCAAAT 62/1.90 CAACATCCTTTACCCATTGACAGA/ GCATTTGATCCACTTGCAGATAAG GGATAACTTCCCTGCCTCAATGA/ TTCTTGTAGCAGCTGAGAGGATCA CATGCGAGTGTCCCTCAATCT/ TCTCTTGCGTTTCTGGCTTAGA CAGCCAGATCTTCACGAGCTT/ ... GTTCTCGCGCATTGACCATA TGAACCACTTGATCTCTGCGACTA/ CAGCTTGCGGAGGTCTGAGT GAGGGTCGTCAGGATTTGGA/ GCCCTGCACTTACCATCTTTAAG CATAACATTTGCGGCAGATCA/ TGGTGGTATTATTGAGCCATCCTT CGCCTGTCAATCTTGGTCAGTAT/ AATGGCTATGCCCCTGTTCTG ... CTTGCATCCCTCAGCACCTT/ TCCTGTGGACAATGGATGGA 82/2.00 GGTTCCCATGTTTACAGCATCTG/ GCACCCACTCAACGGTATTGTAC TCCGCCAAGGACTATCATGAC/ CGCAATCAGAGCCCTGTAGAA GGAGCCTGAGCCTACCTTCTC/ GTGTTCGGCCAGGTGGTAGA GAACTGGGTGCTTGATAGGC/...
- 11
- 376
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose