— a highly promising method for quantifying flavor and fragrance compounds
Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc
Ngày tải lên :
20/02/2014, 22:20
... m a n judges (El-E3) Evaluator E1 is a native Cantonese speaker, E2 a Mandarin speaker, and E3 a speaker of both languages The results are shown in Figure The average accuracy for all evaluators ... generalize to Asian languages? In Pro- ceedings of Pacific Asia Conference on Formal and Computational Linguistics CHURCH, KENNETH 1993 Char_align: A program for aligning parallel texts at the character ... N candidate evaluation is useful because in a machine-aided translation system, we could propose a list of up to, say, ten candidate translations to help the translator We obtained the evaluations...
- 8
- 426
- 0
Báo cáo hóa học: " Research Article A General Iterative Method for Equilibrium Problems and Fixed Point Problems in Hilbert Spaces" pptx
Ngày tải lên :
21/06/2014, 22:20
... Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 [9] A Moudafi, “Viscosity approximation methods for fixed-points problems,” Journal of Mathematical Analysis and Applications, ... Fl˚ m and A S Antipin, “Equilibrium programming using proximal-like algorithms,” a Mathematical Programming, vol 78, no 1, pp 29–41, 1997 Meijuan Shang et al [3] S Takahashi and W Takahashi, ... − A) )(q) Remark 4.2 It is very clear that our algorithm with a variational regularization parameter {rn } has certain advantages over the algorithm with a fixed regularization parameter r In some...
- 9
- 243
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
Ngày tải lên :
10/08/2014, 21:23
... to AS-PCR with nested primers P2 (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) ... 521-bp DNA fragments from genomic DNAs containing wild type and V617F mutation JAK2 were amplified with primers P1 (5’- GATCTCCATATTCCAGGCTTACACA) and P1r (5’- TATTGTTT GGGCATTGTAACCTTCT) and then ... Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73104, USA 2Oklahoma School of Science and Mathematics, Oklahoma City, Oklahoma 73104, USA 3Edmond H Fischer Signal Transduction Laboratory,...
- 7
- 435
- 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
Ngày tải lên :
23/03/2014, 06:20
... concentration, and lactate concentration, within the following physiologically feasible ranges: k kATPase k0 ATPase ATPase (small variation of the energetic load) k kATPase k0 ATPase ATPase (large variation ... effectors, all cellular kinases and phosphatases as potential chemical modiers, and all cellular membranes as potential activating or inactivating scaffolds However, the experimental effort actually ... mechanistic and simplied rate laws Table Ranking of saturation parameters for hepatocyte purine metabolism Average ranking of saturation parameters according to their impact on the dynamic stability...
- 15
- 456
- 0
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx
Ngày tải lên :
20/06/2014, 15:20
... methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities focus on measurement and operational activities associated ... to participation; 2) the ease and speed of participant engagement, facilitation and surveying; and 3) the automated management of resulting transcripts and survey data [4] Demonstration that virtual ... A, Sullivan M, Wood-Dauphinee S, Gandek B, Wagner A, Aaronson N, Bech P, et al.: Translating health status questionnaires and evaluating their quality: the IQOLA Project approach International...
- 14
- 441
- 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
Ngày tải lên :
21/06/2014, 07:20
... Step Calculate rb , Qb in (17) and replace a0 by ak Then go to Step EURASIP Journal on Advances in Signal Processing and the respective inner iterations are three and two in the first and second ... International Symposium on Circuits and Systems, pp 2641–2645, May 1998 [7] T I Laakso, V V¨ lim¨ ki, M Karjalainen, and U K Laine, a a “Splitting the unit: delay tools for fractional delay filter ... IEEE International Symposium on Circuits and Systems, pp 434–437, Sydney, Australia, May 2001 [17] C C Tseng, “Eigenfilter approach for the design of variable fractional delay FIR and all-pass filters,”...
- 10
- 490
- 0
báo cáo hóa học:" Research Article Strong Convergence of a New Iterative Method for Infinite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces" pptx
Ngày tải lên :
21/06/2014, 11:20
... Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 Y Yao, A general iterative method for a finite family of nonexpansive mappings,” Nonlinear Analysis: ... methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H.-K Xu, A general iterative method for nonexpansive mappings ... problems,” Journal of Mathematical Analysis and Applications, vol 344, no 1, pp 340– 352, 2008 S Takahashi and W Takahashi, “Viscosity approximation methods for equilibrium problems and fixed point problems...
- 24
- 398
- 0
Báo cáo hóa học: " Research Article A New Iterative Method for Solving Equilibrium Problems and Fixed Point Problems for Infinite Family of Nonexpansive Mappings" pptx
Ngày tải lên :
21/06/2014, 11:20
... Banach spaces,” Journal of Computational and Applied Mathematics, vol 225, no 1, pp 20–30, 2009 D Kinderlehrer and G Stampacchia, An Introduction to Variational Inequalities and Their Applications, ... methods for equilibrium problems and fixed point problems in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 P L Combettes and S A Hirstoaga, ... 227–239, 2005 19 V Colao, G Marino, and H.-K Xu, “An iterative method for finding common solutions of equilibrium and fixed point problems,” Journal of Mathematical Analysis and Applications, vol 344,...
- 18
- 406
- 0
Báo cáo hóa học: " Research Article An Extragradient Approximation Method for Equilibrium Problems and Fixed Point Problems of a Countable Family of Nonexpansive Mappings" docx
Ngày tải lên :
21/06/2014, 23:20
... extragradient method for fixed point problems and variational inequality problems,” Journal of Inequalities and Applications, vol 2007, Article ID 38752, 12 pages, 2007 11 S Takahashi and W Takahashi, ... K Aoyama, Y Kimura, W Takahashi, and M Toyoda, “Approximation of common fixed points of a countable family of nonexpansive mappings in a Banach space,” Nonlinear Analysis: Theory, Methods & ... paper, motivated by Yao et al 10 , S Takahashi and W Takahashi 11 and Aoyama et al 12 , we introduce a new extragradient method 4.2 which is mixed the iterative schemes considered in 10–12 for...
- 17
- 324
- 0
Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx
Ngày tải lên :
22/06/2014, 02:20
... approximation methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H K Xu, A general iterative method for nonexpansive ... mappings in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 H Iiduka and W Takahashi, “Strong convergence theorems for nonexpansive mappings and ... variational inequality: f − I q, p − q ≤ ∀p ∈ Ω 3.31 Taking A I, γ and f ≡ u ∈ C is a constant in Theorem 3.1, we get the results of Iiduka and Takahashi Journal of Inequalities and Applications...
- 16
- 268
- 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx
Ngày tải lên :
23/06/2014, 00:20
... partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear partial ... equation under consideration into an equivalent linear or nonlinear operator equation in an abstract separable Hilbert H or Banach H1 space Then, after some manipulations, we bring the linear ... Department of Engineering Sciences, Division of Applied Mathematics and Mechanics, University of Patras, 26500 Patras, Greece E-mail address: jenpetro@des.upatras.gr Panayiotis D Siafarikas:...
- 12
- 257
- 0
Báo cáo hóa học: " A Genetic Programming Method for the Identification of Signal Peptides and Prediction of Their Cleavage Sites David Lennartsson" pot
Ngày tải lên :
23/06/2014, 01:20
... individual managed equally well on the training and validation cases and actually had a lower fitness on the validation data than on the training set which indicates that there was no overtraining ... than a random guess, the average distance between the predicted cleavage site and the real cleavage site was calculated A GP Method for the Identification of Signal Peptides Table 2: Performance ... Germany, in 1997 He has worked for several years as a Researcher and Consultant in the area of knowledge-based systems, artificial intelligence, and evolutionary algorithms at Infologics AB, a subsidiary...
- 8
- 430
- 0
Báo cáo toán học: "A graph-theoretic method for choosing a spanning set for a finite-dimensional vector space, with applications to the Grossman-Larson-Wright module and the Jacobian conjecture" pdf
Ngày tải lên :
07/08/2014, 21:21
... The Graph Method It is well known that a square zero pattern matrix guarantees non-singularity if and only if it is permutationally equivalent to a triangular pattern with nonzero diagonal entries: ... theorems on square zero and sign pattern matrices which guarantee nonsingularity to rectangular zero and sign pattern matrices which guarantee full rank In Section we provide background information spelling ... Corollary 3.2.10, summarizing work of Bassett, Maybee and Quirk [3]) Theorem 2.11 and Corollary 2.12 generalize these results to rectangular zero and sign pattern matrices which guarantee full rank...
- 21
- 299
- 0
Báo cáo khoa học: "Visualizing multiple organ failure: a method for analyzing temporal and dynamic relations between failing systems and interventions" pptx
Ngày tải lên :
13/08/2014, 03:21
... Critical Care Vol 11 No Kiliç et al Figure Graphical representation of the performance of LOD, SOFA and MODS: cardiovascular system Shown are data of another patient, illustrating differences ... systems and related interventions We also suggest that this approach could be used as a basis for constructing statistical methods to analyze these relations quantitatively Competing interests YAK ... YAK is the author and director of the Muavenet Intensive Care Information System, which is an open access, online academic information system The other authors declare that they have no competing...
- 2
- 159
- 0
Báo cáo y học: "Comparison between Flotrac-Vigileo and Bioreactance, a totally noninvasive method for cardiac output monitoring" ppt
Ngày tải lên :
13/08/2014, 16:20
... of natural intra-patient CO variability and to determine optimally bias and precision Results are summarized in Table When all very stable CO values were averaged for each patient, correlations ... manual data acquisition and averaging of several measurements In addition, we considered PAC-CCO as a reference for accuracy when the PACCCO trend line slope was nearly flat and when the fluctuation ... the manuscript AC, JCD, and PS conceived of the study, performed the statistical analysis, and collaborated to finalize the manuscript All authors read and approved the final manuscript Page of...
- 6
- 408
- 0
A new numerical method for rotating systems in engineering analysis and design
Ngày tải lên :
16/09/2015, 15:43
... is necessary to apply a coordinate transformation to relate & the fixed frame and rotating frame, Δη = θ + ΩΔt Ω and Ω are the relative rotating speed and relative rotating acceleration of the ... of shear in r − z plane Nγη z Shape functions for evaluation of shear in η − z plane W Radial, tangential and shear stresses Shape functions for displacements and slopes Shape functions for w ... and disc brakes It is noticed that many of these applications involve a rotating annular disk subjected to stationary load In circular saw blade, as the blade rotates to cut an object, in-plane...
- 121
- 451
- 0
Development of a fringe projection method for static and dynamic measurement
Ngày tải lên :
04/10/2015, 15:46
... the deformation and measure deformations Pawlowski [56] applied a spatio-temporal approach, in which the 10 temporal analysis of the intensity variation at a given pixel provides information about ... part establishes the theory for a fringe projection method and its application to shape measurement for both static and dynamic loading conditions Experimental verification for both static shape ... Mr Abdul Malik from the Experimental Mechanics Laboratory I would also like to thank my family Their financial and spiritual support have been enabled me to come to Singapore and study at an advanced...
- 139
- 343
- 0
A Modified Phenylfluorone Method for Determining Organotin Compounds in the ppb and Subppb Range
Ngày tải lên :
06/10/2015, 20:19
... the test area on St Lucia Island in the Caribbean and have been analyzed for residual OTC The environmental samples were treated as described above and the organotin assayed as tin varies from ... Lucia Island in the Caribbean Environmental samples of water, soil, plants, fish, and other aquatic life have been collected and have been qualitatively tested for OTC as follows: Water Samples: ... and Other Aquatic' Specimens: These were totally dissolved in 2-4 mL sulfuric acid and analyzed as described previously Extraction Extraction Extraction Extraction Extractions A set of standard...
- 3
- 304
- 0
A monte carlo method for multi area generation system reliability assessment
Ngày tải lên :
03/01/2014, 19:35
... the available area generation capacity and the area load In the supported set, the available area generation capacity is smaller than the area load A "required load" is defined for each area in ... Table UXE Sensitivity Indices of System and Area to Area Generation and Tie Line Capacities i Case (in Whhear/llW) n I l I Area I Area I Area I Area I System Table I l 1 I I I Area I Area Area ... dependent area loads, load uncertainty (5% standard deviation) and no generating unit derated states Case 4: correlation between area loads, load uncertainty (5% standard deviation) and no generating...
- 6
- 367
- 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
Ngày tải lên :
03/01/2014, 19:44
... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... motor has the following typical features : - The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction...
- 8
- 517
- 1