4 9 lateral view of a recombinant foregut cross section at adult stage and at 4 dpt the ribbons of cells with different colors travel toward the villus tip the ribbons widths vary from 1 white arrowheads to several rows of cells pink ar
The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation
... population between 19 9 7-2006 .11 Table 1: Comparative epidemiology of melioidosis in Southeast Asia and Australia Australia9 Thailand 11 Singapore12 Pahang, Alor Setar, Malaysia13 Malaysia 14 No of ... cases 252 2 217 693 13 5 14 5 Average annual incidence* 19 . 6 12 .7 1. 7 6 .1 16 .4 19 42 .6 16 .2 54 34 Average mortality rate (%) Adapted from Hassan et.al (2 010 ). 14 *per 10 0,000 population per year Several ... CCATGATTACGAATTCGTACGTCGTCGACATGGAC A 60 Hcp1UpR TACCCGGGGATCCTCGATGTGGATTTTCCCGTCAT 60 Hcp1DnF GAG GAT CCC CGG GTA TCA CGT TGA CGA AGG AAA TG 60 Hcp1DnR CCAAGCTTGCATGCCTGCAGCGATCTGCGCTTCG ATTT 60 Hcp1Up3...
- 155
- 1,103
- 0
Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx
... for different activated states of MF (one way ANOVA) To obtain activated states of MF, MF was stimulated by LPS, IL -4, and IL -13 , and then the activated states were evaluated by measuring iNOS and ... two to the ΔΔCT power Statistical analysis Statistical analyses of data were conducted using oneway analysis of variance (ANOVA) Statistical significance was established at p < 0.05 The software ... activated MF And there are mininal effective and maximal concentrations for human MIP- 1a s chemotaxis Human MIP 1a was found to chemoattract NK cells in vitro, and maximal activity was obtained at...
- 7
- 380
- 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf
... incubated with both AA-treated (striped bars) and untreated (black bars) quartz at increasing particle concentration (analysis of variance, P < 0.05) AA-treated quartz suspensions at 15 , 50 and 10 0 ... work was to evaluate the production of COX-2 and prostaglandin E2 (PGE2) in RAW 2 64. 7 cells incubated with AA-treated quartz and to compare it with that induced by untreated quartz particles and ... untreated and AA-treated quartz samples at the same concentration In Fig 5C, data were square-root-transformed and analysed with analysis of variance and the Tukey test; the t-test was used to...
- 14
- 253
- 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
... design and coordination of this project AR conceived the study, participated in the design and coordination, and wrote the final paper All the authors participated in the redrafting and preparation ... RG, Allis CD: Histone acetyltransferases: preparation of substrates and assay procedures Methods Enzymol 19 9 9, 3 04: 675- 696 Wu TT, Kabat EA: An analysis of the sequences of the variable regions of ... hour at 37°C The plates were washed again with PBST Bound antibody was detected by adding goat antihuman IgG alkaline phosphatase conjugate and incubating for hour at 37°C Substrate was added and...
- 13
- 472
- 0
Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf
... 83%) The mean age was 61 years for patients in both parts of the study The mean duration of OA at baseline of Part A was years for the AMG 10 8 group and 10 years for the placebo group; for Part ... (0.5– 24. 0) 1. 0 (0.5 12 .0) 14 4 ( 14 4 –335) 14 4 (48 – 14 5 ) 2580 (665) 8280 (1 690 ) 42 30 (12 10) 244 (15 6) 14 8 (48 ) 96 .3 (38.3) BQL (n = 12 ) (n = 8) * (n = 12 ) (n = 6) * 315 ( 91 ) 96 0 ( 19 2 ) 397 (12 3) 41 .4 (11 .1) ... in the assay Statistical analysis Patient data were analyzed according to randomized treatment arm regardless of actual treatment received during the study The safety dataset included all patients...
- 30
- 277
- 0
Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf
... Additional data file Matlab code and the data can be obtained upon request Additional data files The following additional data are available with the online version of this paper Additional data file ... used in which the desired standard deviation is calculated implicitly by utilizing the latent variables of the input data and the standard deviation of the population of output data The procedure ... 2.53 on the training data and from 2.88 to 2. 49 on the test data) MIP -1 data are characterized by a high variance and data can simply be difficult to fit because of imprecision in the measurements...
- 14
- 182
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... K) after addition of various amounts of molar ratios of Yb3+ (as YbCl3) The two absorption bands at 242 and 295 nm are indicative of Yb3+ binding to the specific iron sites of Tf Molar ratio from ... of e (top) and k (bottom) on the molar ratio of Yb3+ to apo-Tf In the lower panel the data of k1, k2 and k over the range of the ratio [Yb3+]/protein between and are linearly fitted: k1 ¼ 1. 268x ... differences in rate constants The almost identical molar absorptivity of e1 and e and approximately the same slope of the k1 and k (Fig 3) suggeststhatthenatureofthefirstkineticphaseofthereaction between...
- 9
- 385
- 0
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
... that CEACAMs are capable of regulating the function of CD 11/ CD18 [ 24, 39, 40 ], and induce an increase in intracytoplasmic calcium and an oxidative burst in neutrophils [27] CEACAM1 also regulates ... Tyr488 in the cytoplasmic domain of CEACAM1; this complex may play a role in cell invasion [10 1] During cellmatrix adhesion of endothelial cells, CEACAM1 associates with talin, a regulator of ... part by the American Heart Association, Minnesota Affiliate, NIH grant CA60658, the Office of the Vice President for Research and Dean of the Graduate School of the University of Minnesota, the...
- 12
- 599
- 0
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf
... supported by the Multiple Sclerosis Society of Canada AP and NA hold Donald Paty Career Development Awards from the MSSC and are Research Scholars from the Fonds de la Recherche en Page 11 of 12 Santé ... mutants Am J Pathol 20 09, 1 74: 2 290 -2 299 Salama AD, Chitnis T, Imitola J, Ansari MJ, Akiba H, Tushima F, Azuma M, Yagita H, Sayegh MH, Khoury SJ: Critical role of the programmed death -1 (PD -1) pathway ... PD-L1 levels on CNS cells Glia 2 011 , 59: 8 41 -856 Ansari MJ, Salama AD, Chitnis T, Smith RN, Yagita H, Akiba H, Yamazaki T, Azuma M, Iwai H, Khoury SJ, et al: The programmed death -1 (PD -1) pathway...
- 12
- 294
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... B7 .1, and B7.2 surface expression (Figure 3) The expression levels are comparable between hES-DCs and FL-DCs: CD 1a+ HLA-DR+ (10 .5% and 9. 6%), CD 1a+ B7 .1+ ( 14 % and 15 .4% ), and CD 1a+ B7.2+ (11 .4% and 12 .9% ) ... citation purposes) AIDS Research and Therapy 2008, 5 :1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Martin CH, Kaufman DS: Synergistic use of adult and embryonic stem cells to study human ... from hES and FL CD 34+ cells: CD 34+ cells were cultured in cytokine media and analyzed by FACS for CD 14 and CD 1a markers at different days by staining with CD 1a- PECY5 and CD 14 - PE conjugated antibodies...
- 9
- 261
- 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn
... tiêu chuẩn Bộ điều áp II 90 A hay thấp 11 .5V 1. 25 – 1. 29 12 .5 – 12 .9V 12 .9 – 14 . 9V 1 0A hay nhỏ Bảo dưỡng: Kiểm tra máy khởi động: - Kiểm tra chức kéo: + Tháo dây dẫn cuộn Stato khỏi cực C Nối ắcquy ... chuẩn phải thay 47 Kiểm tra độ kín khít bầu phanh hệ thống phanh xy lanh phanh hệ thống phanh dầu Kiểm tra mức dầu bầu ch a xy lanh phanh 48 Điều chỉnh khe hở tang trống, đ a phanh má phanh, hành ... 35 Khắc phục S a ch a Thay phớt dầu Thay gioăng S a ch a S a van dầu S a bơm dầu Thay dầu Thay bạc Thay bạc Thay lọc dầu S a ch a van tràn 2.2.3 HỆ THỐNG LÀM MÁT: Hình 2.3 Tổng quan hệ thống làm...
- 118
- 4,294
- 56
8 cách đơn giản tăng tốc windows 7
... thị Toolbar: Tính hiển thị thumbnail cu a các cư a sổ mở taskbar là một các tính hữu ích cu a Windows Thủ thuật dưới sẽ giúp bạn cải thiện thời gian hiển thị các hình a nh ... Properties, c a sổ ra, bạn chuyển qua thẻ General, phần Startup Type chọn Disable Các dịch vụ tắt mà không ảnh hưởng đến công việc bạn: ASP.NET State Service, Automatic Updates, Help and Support, ... Enter - Tại cư a sổ System Configuration hiện ra, chọn tab Boot và nhấn vào nút Advanced Options… - a nh dấu vào mục Number of processors và chọn số nhân cu a cpu mà máy tính...
- 19
- 440
- 0
cac nguyen to thuoc nhom 7
... thứ tự Cl 17 35 53 85 2s22p5 3s23p5 4s24p5 5s25p5 6s26p5 Bán kính ngtử (Å) 0, 64 0 ,99 1, 14 1, 33 1 ,40 N.lượng ion h a I1 17 ,42 13 , 01 11, 84 10 ,45 9, 50 Ái lực electron (eV) 3,58 3, 81 3,56 3, 29 - Độ ... sôi (0C) 19 , 5 - 84 ,9 - 66,7 - 35,8 N.Lượng lk H – X (kJ/mol) 565 43 1 3 64 297 Độ dài lk H – X (Å) 0 ,92 1, 27 1 , 41 1, 60 Độ phân ly α(200C;0,1N;%) 9, 0 92 ,6 93 ,5 95 ,0 Độ phân cực µ (D) Độ tan (00C; ... 4KOH = 2K2MnO4 + 2H2O 43 HỢP CHẤT C A MANGAN Hợp chất Mn +7 Kali pemanaganat (KMnO4): tinh thể màu tím đen, dung dịch màu tím đỏ, độ tan biến đổi theo nhiệt độ Ngoài ra, thể tan amoniac lỏng, pyriđin,...
- 45
- 754
- 2
Essential guide to writing part 7
... sentences of the following paragraph relate to its ideas The analysis might begin like this: Sentence Idea Topic: a paradox about grammar Specification: first part of the paradox—people regard grammar ... both.) The first is to For more material and information, please visit www.tailieuduhoc.org 98 THE EXPOSITORY PARAGRAPH establish a master plan at the beginning of the paragraph and to introduce each ... highly educated people seldom have a clear idea of what grammarians do, and there is an unfortunate confusion about the meaning of the term "grammar" itself W Nelson Francis For more material and information,...
- 15
- 371
- 0
British English A to Z - past 7
... mash, n mashed potatoes Inf Occasionally, creamed potatoes in Britain A pub used to present sausages and mash in the public bar at three shillings and sausages and creamed potatoes in the saloon ... customary for the other M.P.s not to interrupt, and to praise the speech afterwards After the maiden speech the M.P is fair game for the robust comments that characterize parliamentary debate maid ... the metals in Britain it has been derailed rails meteorological office weather bureau And the much reviled official whom the Americans call the weatherman is the clerk of the weather in Britain...
- 29
- 443
- 0
Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7
... học kỳ I môn to n - lớp Thời gian làm bài: 90 phút Câu 1: Mỗi câu trả lời đợc 0.25đ câu đáp án Đ S đ s Câu 2: Mỗi ý đợc 0.25đ câu a b c d đáp án a c d b Tự luận: THPT: Mỗi câu 0.5đ a 20 b -36 c ... -36 c Tìm x: Mỗi câu 0.5đ a x= 28 b x =9 c x= 16 x= Gọi ẩn viết đợc tỷ lệ thức: 1 - áp dụng tính chất dãy tỉ số có kết đúng: 1 + Lớp 7A: 35cây + Lớp 7B: 25 + Lớp 7C: 15 cây Vẽ hình viết giải thiết, ... 15 cây Vẽ hình viết giải thiết, kết luận đúng: 0.5đ a) Chứng minh đợc tam giác ABC = tam giác ADE 0.75đ b) Chứng minh đợc DE//BC c) Chứng minh đợc AF=AC CFEF 0.75đ 0.5đ ...
- 2
- 447
- 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc
... they would tackle a given brief • Press Pack/Kit: a branded pack handed out to the media by an organisation It normally contains background material, photographs, illustrations and news releases ... relevant articles to the respective publications, responding to media enquiries, and providing appropriate information on behalf of an organisation • Messages: agreed words or statements that a ... newsletters and intranets • Logo: A graphic or symbol owned by and representing a company or brand • Media Relations: communicating with the media by pro-actively speaking to journalists and sending...
- 2
- 490
- 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt
... link sau vào Windows Explorer mục Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu bạn có dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi bạn dán folder này, bạn di ... hệ điều hành Windows XP, vào Control Panel > Folder Options > Show hidden files and folders Chuyển tới C:\Documents and Settings\[User Name]\SendTo (User Name tên máy tính bạn) tạo shortcut cho ... giúp bạn lưu chia sẻ liệu Nếu bạn muốn dễ dàng truy cập ứng dụng này, bạn thêm vào menu Send To menu context Thêm Dropbox vào mục Send To Windows Vista Đầu tiên, copy đường link sau vào Windows...
- 8
- 385
- 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx
... BHUBANESHWAR 14 CHANDIGARH 15 CHENNAI 16 DELHI 17 GUWAHATI 18 HYDERABAD 19 10 JAMMU 20 11 JAIPUR 21 12 KOLKATA 22 13 LUCKNOW 23 14 MUMBAI 24 15 PATNA 25 Address of the Circle Office of the Bank ... Road, Jaipur 302 015 Tel No 0 14 1 - 2 747 1 14 , 2 747 1 09 Fax No 0 14 1 – 2 747 1 09, 2 747 13 3 AG Tower, 3rd Floor, 12 5 /1, Park Street,, Kolkata 700 017 Tel No 033 - 226 49 9 07 226 49 9 34 No 033 – 22 2 91 5 14 4,Vibhuti ... an academic discipline other than that of the candidate The academic stream of the scribe should be different from that of the candidate iv) Both the candidate as well as the scribe will have to...
- 17
- 347
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008